Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU108861

Sigma-Aldrich

MISSION® esiRNA

targeting human IGF2BP3

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTATCAGTCGGTGCCATCATCGGCAAGCAGGGCCAGCACATCAAGCAGCTTTCTCGCTTTGCTGGAGCTTCAATTAAGATTGCTCCAGCGGAAGCACCAGATGCTAAAGTGAGGATGGTGATTATCACTGGACCACCAGAGGCTCAGTTCAAGGCTCAGGGAAGAATTTATGGAAAAATTAAAGAAGAAAACTTTGTTAGTCCTAAAGAAGAGGTGAAACTTGAAGCTCATATCAGAGTGCCATCCTTTGCTGCTGGCAGAGTTATTGGAAAAGGAGGCAAAACGGTGAATGAACTTCAGAATTTGTCAAGTGCAGAAGTTGTTGTCCCTCGTGACCAGACACCTGATGAGAATGACCAAGTGGTTGTCAAAATAACTGGTCACTTCTATGCTTGCCAGGTTGCCCAGAGAAAAATTCAGGAAATTCTGACTCAGGTAAAGCAGCACCAACAACAGAAGGCTCTGCAAAGTGGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yonglei Liu et al.
Journal of cellular and molecular medicine, 21(9), 1979-1988 (2017-05-20)
CD44, a cell adhesion protein, involves in various process in cancer such as cell survival and metastasis. Most researches on CD44 in cancer focus on cancer cells. Recently, it is found that CD44 expression is high in fibroblasts of tumour
Huidi Liu et al.
Frontiers in oncology, 9, 1570-1570 (2020-02-23)
Ovarian Clear Cell Carcinoma (OCCC) displays distinctive clinical and molecular characteristics and confers the worst prognosis among all ovarian carcinoma histotypes when diagnosed at advanced stage, because of the lack of effective therapy. IGF2BP3 is an RNA binding protein that
Douglas Hanniford et al.
Cancer cell, 37(1), 55-70 (2020-01-15)
Metastasis is the primary cause of death of cancer patients. Dissecting mechanisms governing metastatic spread may uncover important tumor biology and/or yield promising therapeutic insights. Here, we investigated the role of circular RNAs (circRNA) in metastasis, using melanoma as a

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service