Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU085221

Sigma-Aldrich

MISSION® esiRNA

targeting human SHC1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTGTGGTTCGGACTAAGGATCACCGCTTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGATCTGCCCTAGCGCTCTCTTCCAGAAGATGCCCTCCAATCCTTTCCACCCTATTCCCTAACTCTCGGGACCTCGTTTGGGAGTGTTCTGTGGGCTTGGCCTTGTGTCAGAGCTGGGAGTAGCATGGACTCTGGGTTTCATATCCAGCTGAGTGAGAGGGTTTGAGTCAAAAGCCTGGGTGAGAATCCTGCCTCTCCCCAAACATTAATCACCAAAGTATTAATGTACAGAGTGGCCCCTCACCTGGGCCTTTCCTGTGCCAACCTGAT

Ensembl | human accession no.

ENSG00000160691

NCBI accession no.

NM_183001

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SHC1(6464) , SHC1(6464)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yukun Zhang et al.
Aging, 12(3), 2049-2069 (2020-02-06)
Hepatic steatosis and oxidative stress are considered to be the sequential steps in the development of non-alcoholic fatty liver disease (NAFLD). We previously found that catalpol, an iridoid glucoside extracted from the root of Romania glutinosa L, protected against diabetes-induced
Hyo Jung Shin et al.
International journal of nanomedicine, 15, 2379-2390 (2020-04-21)
Osteoarthritis (OA) is the most common type of joint disease associated with cartilage breakdown. However, the role played by mitochondrial dysfunction in OA remains inadequately understood. Therefore, we investigated the role played by p66shc during oxidative damage and mitochondrial dysfunction
Zhecheng Wang et al.
Molecular therapy. Nucleic acids, 21, 751-763 (2020-08-12)
We previously found that inhibition of p66Shc confers protection against hepatic stellate cell (HSC) activation during liver fibrosis. However, the effect of p66Shc on HSC proliferation, as well as the mechanism by which p66Shc is modulated, remains unknown. Here, we
Shuyu Piao et al.
Biochemical and biophysical research communications, 522(4), 869-875 (2019-12-07)
Inhibition of mitochondrial protein CR6 interacting factor 1 (CRIF1) disturbs mitochondrial function, depolarizes membrane potential, and increases reactive oxygen species (ROS) levels in endothelial cells. Impaired mitochondrial function accompanied by oxidative damage is a major contributor to the initiation of
Nara Shin et al.
Polymers, 12(5) (2020-05-06)
p66shc, a member of the shc adaptor protein family, has been shown to participate in regulation of mitochondrial homeostasis, apoptosis, and autophagosome formation. The present study was performed to investigate whether p66shc siRNA-encapsulated poly(d,l-lactic-co-glycolic acid) nanoparticles (p66shc siRNA-PLGA NPs) can

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service