Product EHU084381 has not been tested internally in mouse but the esiRNA cDNA target sequence for EHU084381 has 100% homology against Mus musculus lysine demethylase 5B (Kdm5b), mRNA, NM_152895.2.
Select a Size
20 μG
$220.00
50 μG
$391.00
$220.00
Usually ships in 3 weeks (4 to 6 weeks for custom orders).
All Photos(1)
Select a Size
Change View
20 μG
$220.00
50 μG
$391.00
About This Item
UNSPSC Code:
41105324
NACRES:
NA.51
$220.00
Usually ships in 3 weeks (4 to 6 weeks for custom orders).
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGAGCATTATCGCTTGCTTCATCGATATTGTGTGTTTTCCCACGATGAGATGATCTGCAAGATGGCTTCCAAGGCTGATGTATTAGATGTTGTAGTGGCTTCAACTGTTCAGAAAGACATGGCCATTATGATTGAGGATGAGAAAGCTTTAAGAGAAACTGTCCGTAAATTGGGAGTGATTGATTCGGAAAGAATGGATTTTGAGCTGTTGCCAGATGATGAACGTCAGTGTGTAAAATGCAAAACTACATGCTTCATGTCTGCCATCTCCTGTTCTTGTAAACCTGGCCTTCTTGTTTGCCTGCATCATGTAAAAGAATTGTGTTCCTGTCCTCCTTACAAATATAAATTGCGGTATAGGTACACGCTGGATGATCTCTACCCTATGATGAATGCATTGAAGCTTCGAGCAGAATCTTACAACGAATGGGCCTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... KDM5B(10765) , JARID1B(10765)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Kuang-Tai Kuo et al.
Clinical epigenetics, 10(1), 107-107 (2018-08-11)
Lung cancer is the leading cause of cancer death worldwide. Recently, epigenetic dysregulation has been known to promote tumor progression and therefore may be a therapeutic target for anticancer therapy. JARID1B, a member of histone demethylases, has been found to
Chun-Shu Lin et al.
Cancer letters, 368(1), 36-45 (2015-07-18)
Oral squamous cell carcinoma (OSCC) is a major cause of human mortality globally and radiotherapy is one of the main treatment modalities, however its therapeutic effect is often limited by radioresistance. JARID1B is an epigenetic factor with reported oncogenic potential
-
Hi - could you please let me know if esiRNA against KDM5B (human) also targets the mouse transcript? Thank you!
1 answer-
Helpful?
-
Active Filters
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service
