The RefSeq transcript used for the esiRNA design for MOCS2 is NM_004531. Although there is no testing to confirm that both MOCS2A and MOCS2B are knocked down, the NCBI notes for this RefSeq indicate "undisturbed production of both transcripts," meaning MOCS2A and MOCS2B. The expectation is that the esiRNA will target both, as the targeting sequence should be conserved in both isoforms.
Select a Size
$220.00
Select a Size
About This Item
$220.00
Recommended Products
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GACATCCTGGATTGGCTGATGTTAGAAATCAGATAATATTTGCTGTTCGTCAAGAATATGTCGAGCTTGGAGATCAGCTCCTCGTGCTTCAGCCTGGAGACGAAATTGCCGTTATCCCCCCCATTAGTGGAGGATAGTGCTTTTGAGCCATCTAGGAAAGATATGGATGAAGTTGAAGAGAAATCTAAAGATGTTATAAACTTTACTGCCGAGAAACTTTCAGTAGATGAAGTCTCACAGTTGGTGATTTCTCCGCTCTGTGGTGCAATATCCCTATTTGTAGGGACTACAAGAAATAACTTTGAAGGGAAAAAAGTCATTAGCTTAGAATATGAAGCATATCTACCCATGGCGGAAAATGAAGTCAGAAAGATTTGTAGTGACATTAGGCAGAAATGGCCAGTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MOCS2(4338) , MOCS2(4338)
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
If you need assistance, please contact Customer Support.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
-
I want to know if its MOCS2A or MOCS2B, or does it work for both?. I have bought this product and its for a esiRNA screen.
1 answer-
Helpful?
-
Active Filters
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service