Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU076001

Sigma-Aldrich

MISSION® esiRNA

targeting human YWHAZ

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAAGCCACAATGTTCTTGGCCCATCATGACATTGGGTAGCATTAACTGTAAGTTTTGTGCTTCCAAATCACTTTTTGGTTTTTAAGAATTTCTTGATACTCTTATAGCCTGCCTTCAATTTTGATCCTTTATTCTTTCTATTTGTCAGGTGCACAAGATTACCTTCCTGTTTTAGCCTTCTGTCTTGTCACCAACCATTCTTACTTGGTGGCCATGTACTTGGAAAAAGGCCGCATGATCTTTCTGGCTCCACTCAGTGTCTAAGGCACCCTGCTTCCTTTGCTTGCATCCCACAGACTATTTCCCTCATCCTATTTACTGCAGCAAATCTCTCCTTAGTTGATGAGACTGTGTTTATCTCCCTTTAAAACCCTACCTATCCTGAATGGTCTGTCATTGTCTGCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wenrui Wang et al.
Cell death & disease, 8(10), e3071-e3071 (2017-10-06)
MicroRNAs (miRNAs) have been identified as major post-transcriptional regulators of the initiation and progression of human cancers, including breast cancer. However, the detail role of miR-451 has not been fully elucidated in breast cancer. In this study, we aimed to
Lei Yan et al.
Environmental toxicology, 35(9), 1015-1028 (2020-05-19)
Breast cancer (BC) is the leading cause of cancer-related death in women worldwide and one of the most prevalent malignancy. In recent years, increasing evidence had illuminated that long noncoding RNAs (lncRNAs) serve as critical factors in multiple tumor progression
Jie Shi et al.
Oncology reports, 41(2), 1101-1112 (2018-12-12)
Ovarian cancer is one of the three most deadly gynecological cancers, with the highest mortality rate. As the main cause of death, metastasis is considered to be a crucial factor that reduces the survival time of ovarian carcinoma patients. YWHAZ
Langyong Mao et al.
American journal of cancer research, 5(6), 1939-1953 (2015-08-14)
The deregulation of microRNAs has been demonstrated in various tumor processes. Here, we report that microRNA-544 (miR-544) is decreased in cervical cancer tissues compared with normal cervical tissues. To identify the mechanisms involved in miR-544 deregulation, we studied the regulation
Gareth E Lim et al.
Nature communications, 6, 7671-7671 (2015-07-30)
The proteins that coordinate complex adipogenic transcriptional networks are poorly understood. 14-3-3ζ is a molecular adaptor protein that regulates insulin signalling and transcription factor networks. Here we report that 14-3-3ζ-knockout mice are strikingly lean from birth with specific reductions in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service