Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU075731

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXO4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAAGCTCTTGGTGGATGCTGAACCCTGAGGGAGGCAAGAGCGGCAAAGCCCCCCGCCGCCGGGCCGCCTCCATGGATAGCAGCAGCAAGCTGCTCCGGGGCCGCAGTAAAGCCCCCAAGAAGAAACCATCTGTGCTGCCAGCTCCACCCGAAGGTGCCACTCCAACGAGCCCTGTCGGCCACTTTGCCAAGTGGTCAGGCAGCCCTTGCTCTCGAAACCGTGAAGAAGCCGATATGTGGACCACCTTCCGTCCACGAAGCAGTTCAAATGCCAGCAGTGTCAGCACCCGGCTGTCCCCCTTGAGGCCAGAGTCTGAGGTGCTGGCGGAGGAAATACCAGCTTCAGTCAGCAGTTATGCAGGGGGTGTCCCTCCCACCCTCAATGAAGGTCTAGAGCTGTTAGATGGGCTCAATCTCACCTCTTCCCATTCCCTGCTATCTCGGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nikolaos Doumpas et al.
The EMBO journal, 38(2) (2018-11-15)
During canonical Wnt signalling, the activity of nuclear β-catenin is largely mediated by the TCF/LEF family of transcription factors. To challenge this view, we used the CRISPR/Cas9 genome editing approach to generate HEK 293T cell clones lacking all four TCF/LEF
Linna Su et al.
BMC cancer, 14, 378-378 (2014-06-03)
FOXO4, a member of the FOXO family of transcription factors, is currently the focus of intense study. Its role and function in gastric cancer have not been fully elucidated. The present study was aimed to investigate the expression profile of
Yanying Liu et al.
Human molecular genetics, 26(22), 4416-4428 (2017-10-04)
Although it has been speculated that proteasome dysfunction may contribute to the pathogenesis of Huntington's disease (HD), a devastating neurodegenerative disorder, how proteasome activity is regulated in HD affected stem cells and somatic cells remains largely unclear. To better understand
Jianbin Zhang et al.
Autophagy, 11(4), 629-642 (2015-04-29)
Autophagy is a catabolic process in response to starvation or other stress conditions to sustain cellular homeostasis. At present, histone deacetylase inhibitors (HDACIs) are known to induce autophagy in cells through inhibition of mechanistic target of rapamycin (MTOR) pathway. FOXO1

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service