Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU067061

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKCD

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGTCTATGCGCAGTGAGGACGAGGCCAAGTTCCCAACGATGAACCGCCGCGGAGCCATCAAACAGGCCAAAATCCACTACATCAAGAACCATGAGTTTATCGCCACCTTCTTTGGGCAACCCACCTTCTGTTCTGTGTGCAAAGACTTTGTCTGGGGCCTCAACAAGCAAGGCTACAAATGCAGGCAATGTAACGCTGCCATCCACAAGAAATGCATCGACAAGATCATCGGCAGATGCACTGGCACCGCGGCCAACAGCCGGGACACTATATTCCAGAAAGAACGCTTCAACATCGACATGCCGCACCGCTTCAAGGTTCACAACTACATGAGCCCCACCTTCTGTGACCACTGCGGCAGCCTGCTCTGGGGACTGGTGAAGCAGGGATTAAAGTGTGAAGACTGCGGCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Markus Dietrich et al.
Experimental cell research, 382(2), 111473-111473 (2019-06-25)
ErbB3, which belongs to the epidermal growth factor receptor (EGFR) or ErbB family of receptor tyrosine kinases, is involved in progression of several human cancers and a tight regulation of its expression is crucial. An important mechanism for regulation of
Zoé Lama et al.
Antiviral research, 168, 51-60 (2019-05-10)
Rabies virus (RABV) is a neurotropic virus that causes fatal encephalitis in humans and animals and still kills up to 59,000 people worldwide every year. To date, only preventive or post-exposure vaccination protects against the disease but therapeutics are missing.
Sara G Pollan et al.
Oncogene, 37(21), 2817-2836 (2018-03-08)
Tumor metastasis depends on the dynamic regulation of cell adhesion through β1-integrin. The Cub-Domain Containing Protein-1, CDCP1, is a transmembrane glycoprotein which regulates cell adhesion. Overexpression and loss of CDCP1 have been observed in the same cancer types to promote
Fumihiko Urabe et al.
Science advances, 6(18), eaay3051-eaay3051 (2020-06-05)
Extracellular vesicles (EVs) are involved in intercellular communication during cancer progression; thus, elucidating the mechanism of EV secretion in cancer cells will contribute to the development of an EV-targeted cancer treatment. However, the biogenesis of EVs in cancer cells is

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service