Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU047441

Sigma-Aldrich

MISSION® esiRNA

targeting human NQO1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCGCAGACCTTGTGATATTCCAGTTCCCCCTGCAGTGGTTTGGAGTCCCTGCCATTCTGAAAGGCTGGTTTGAGCGAGTGTTCATAGGAGAGTTTGCTTACACTTACGCTGCCATGTATGACAAAGGACCCTTCCGGAGTAAGAAGGCAGTGCTTTCCATCACCACTGGTGGCAGTGGCTCCATGTACTCTCTGCAAGGGATCCACGGGGACATGAATGTCATTCTCTGGCCAATTCAGAGTGGCATTCTGCATTTCTGTGGCTTCCAAGTCTTAGAACCTCAACTGACATATAGCATTGGGCACACTCCAGCAGACGCCCGAATTCAAATCCTGGAAGGATGGAAGAAACGCCTGGAGAATATTTGGGATGAGACACCACTGTATTTTGCTCCAAGCAGCC

Ensembl | human accession no.

ENSG00000181019

NCBI accession no.

NM_001025434

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NQO1(1728) , NQO1(1728)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Brian Madajewski et al.
Molecular cancer research : MCR, 14(1), 14-25 (2015-11-11)
The fundamental role that NAD(P)H/quinone oxidoreductase 1 (NQO1) plays, in normal cells, as a cytoprotective enzyme guarding against stress induced by reactive oxygen species (ROS) is well documented. However, what is not known is whether the observed overexpression of NQO1
Masahiro Sekiguchi et al.
NPJ precision oncology, 4, 20-20 (2020-07-14)
Although hepatoblastoma is the most common pediatric liver cancer, its genetic heterogeneity and therapeutic targets are not well elucidated. Therefore, we conducted a multiomics analysis, including mutatome, DNA methylome, and transcriptome analyses, of 59 hepatoblastoma samples. Based on DNA methylation
Siriwoot Butsri et al.
Oncology letters, 13(6), 4540-4548 (2017-06-11)
We previously reported that upregulation of NAD(P)H:quinone oxidoreductase 1 (NQO1) in cholangiocarcinoma (CCA; a fatal bile duct cancer) was associated with poor prognosis. It was also demonstrated that the suppression of NQO1 was able to enhance the chemosensitivity of CCA
Peter Tsvetkov et al.
Frontiers in pharmacology, 12, 671929-671929 (2021-07-09)
Silent information regulator 2-related enzyme 1 (SIRT1) is an NAD+-dependent class III deacetylase and a key component of the cellular metabolic sensing pathway. The requirement of NAD+ for SIRT1 activity led us to assume that NQO1, an NADH oxidoreductase producing
Christophe Glorieux et al.
Antioxidants (Basel, Switzerland), 8(9) (2019-09-05)
Cancer cell sensitivity to drugs may be associated with disturbed antioxidant enzymes expression. We investigated mechanisms of resistance by using oxidative stress-resistant MCF-7 breast cancer cells (Resox cells). Since nicotinamide adenine dinucleotide phosphate (NAD(P)H): quinone oxidoreductase-1 (NQO1) is modified in
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service