Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU046211

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF2C

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00

Usually ships in 3 weeks (4 to 6 weeks for custom orders).
All Photos(1)

Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00

Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTCGGGCTACTTTGGAATGTCATCCACTTACTATGACTGATCCTATCGAAGAGCACAGAATATGTGTCTGTGTTAGGAAACGCCCACTGAATAAGCAAGAATTGGCCAAGAAAGAAATTGATGTGATTTCCATTCCTAGCAAGTGTCTCCTCTTGGTACATGAACCCAAGTTGAAAGTGGACTTAACAAAGTATCTGGAGAACCAAGCATTCTGCTTTGACTTTGCATTTGATGAAACAGCTTCGAATGAAGTTGTCTACAGGTTCACAGCAAGGCCACTGGTACAGACAATCTTTGAAGGTGGAAAAGCAACTTGTTTTGCATATGGCCAGACAGGAAGTGGCAAGACACATACTATGGGCGGAGACCTCTCTGGGAAAGCCCAGAATGCATCCAAAGGGAT

Ensembl | human accession no.

ENSG00000142945

NCBI accession no.

NM_006845

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KIF2C(11004) , KIF2C(11004)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
QCS

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ashley Mooneyham et al.
Molecular cancer research : MCR, 17(2), 370-383 (2018-10-17)
UNC-45A, a highly conserved member of the UCS (UNC45A/CRO1/SHE4P) protein family of cochaperones, plays an important role in regulating cytoskeletal-associated functions in invertebrates and mammalian cells, including cytokinesis, exocytosis, cell motility, and neuronal development. Here, for the first time, UNC-45A
Haibo Wang et al.
Oncotarget, 8(30), 48671-48687 (2017-04-19)
Defects in resolving kinetochore-microtubule attachment mistakes during mitosis is linked to chromosome instability associated with carcinogenesis as well as resistance to cancer therapy. Here we report for the first time that tumor suppressor p53-binding protein 1 (53BP1) is phosphorylated at
Rui-Chao Chai et al.
Carcinogenesis, 40(10), 1229-1239 (2019-06-04)
1p/19q codeletion, which leads to the abnormal expression of 1p19q genes in oligodendroglioma, is associated with chemosensitivity and favorable prognosis. Here, we aimed to explore the clinical implications of 1p19q gene expression in 1p/19q non-codel gliomas. We analyzed expression of
Chenyu Li et al.
Scientific reports, 6, 18773-18773 (2016-01-07)
Nucleolar and spindle-associated protein (NuSAP) is a microtubule-associated protein that functions as a microtubule stabiliser. Depletion of NuSAP leads to severe mitotic defects, however the mechanism by which NuSAP regulates mitosis remains elusive. In this study, we identify the microtubule
Jonathan W Armond et al.
Journal of cell science, 128(10), 1991-2001 (2015-04-25)
Kinetochores regulate the dynamics of attached microtubule bundles (kinetochore-fibres, K-fibres) to generate the forces necessary for chromosome movements in mitosis. Current models suggest that poleward-moving kinetochores are attached to depolymerising K-fibres and anti-poleward-moving kinetochores to polymerising K-fibres. How the dynamics
View All Related Papers

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service