Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU034581

Sigma-Aldrich

MISSION® esiRNA

targeting human GOLPH3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCAACAGGGGATGTTCTTCTTGATGAAGCTCTGAAGCATGTTAAGGAAACTCAGCCTCCAGAAACGGTCCAGAACTGGATTGAATTACTTAGTGGTGAGACATGGAATCCATTAAAATTGCATTATCAGTTAAGAAATGTACGGGAACGATTAGCTAAAAACCTGGTGGAAAAGGGTGTATTGACAACAGAGAAACAGAACTTCCTACTTTTTGACATGACAACACATCCCCTCACCAATAACAACATTAAGCAGCGCCTCATCAAGAAAGTACAGGAAGCCGTTCTTGACAAATGGGTGAATGACCCTCACCGCATGGACAGGCGCTTGCTGGCCCTCATTTACCTGGCTCATGCCTCGGACGTCCTGGAGAATGCTTTTGCTCCTCTTCTGGACGAGCAGTATGATTTGGCTACCAAGAGAGTGCGGCAGCTTCTCGACTTAGACCCTGAAGTGGAATGTCTGAAGGCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tao Yu et al.
Life sciences, 260, 118294-118294 (2020-08-21)
To explore whether GOLPH3 regulated oxaliplatin (L-OHP) resistance of colon cancer cells via PI3K/AKT/mTOR pathway. HCT116/L-OHP cells were divided into Blank, Control/GOLPH3 shRNA, BEZ235 (a PI3K/AKT/mTOR inhibitor), and GOLPH3 + BEZ235 groups followed by the detection with MTT, soft agar colony formation
Dong Lu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 47(6), 2445-2457 (2018-07-11)
Golgi phosphoprotein 3 (GOLPH3) plays pro-malignancy roles in several types of cancer. However, the molecular mechanism underlying GOLPH3 promoting tumor progression remains poorly understood. The expression of GOLPH3 and Wntless (Wls) in glioma tissues was examined by western blotting and
Qian Li et al.
Molecular medicine reports, 11(6), 4315-4320 (2015-01-31)
Golgi phosphoprotein 3 (GOLPH3) overexpression has previously been associated with the progression of several solid tumors, which resulted in adverse clinical outcomes. The present study aimed to determine the expression and prognostic significance of GOLPH3 in human hepatocellular carcinoma (HCC). GOLPH3

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service