Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU034241

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC13A2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTCAGCCTGCACTCTTTCCCCTCCTGGGCACAGTCCAACACCACAGCCCAGTGCCTGCCAAGCCTGGCCAACACCACCACACCAAGCCCCTAGGCTGGGGCACAGCCTGGCCATGCCCAGGAAGACCCACCCCATTCCCACTCCTCTGAGCCCGGAGGGGACACCCCAAGCTCCAAGCTCCAAGCTCCAGGCCAAAGGCTGAAAGGCACGTGTGTACATAATCTCTTGCGTGTCTGTAAGGAAGGGGTGTATGCTCAGTTTCCTATGTGCTGGAATAAAAGGTGTGTGCATGTGTGTGTGCGCATATGTGTGCGCCTGCATGGATGTGAGGGGTGTGTGACGTGAGGCTATCTGAGGGGGGCTGTGTGCATGCACATGATCCTAGGTATGTATGTTGGACAGTGCACACGTGTGTGTTCACAGACAATACAACATGCCCTCTCTGGTGCCCCAGGTCTTGGTATCCCCAGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Neil R Hackett et al.
PloS one, 6(5), e18378-e18378 (2011-05-17)
The human airway epithelium consists of 4 major cell types: ciliated, secretory, columnar and basal cells. During natural turnover and in response to injury, the airway basal cells function as stem/progenitor cells for the other airway cell types. The objective
Lynne Bingle et al.
Respiratory research, 7, 61-61 (2006-04-08)
The Whey Acidic Protein domain is an evolutionarily conserved motif found in a number of proteins, the best studied of which are antiproteinases involved in the innate immune defence of multiple epithelia. We recently characterised the WFDC2 gene which encodes
Lynne Bingle et al.
Histochemistry and cell biology, 138(5), 749-758 (2012-07-07)
Although the biology the PLUNC (recently renamed BPI fold, BPIF) family of secreted proteins is poorly understood, multiple array based studies have suggested that some are differentially expressed in lung diseases. We have examined the expression of BPIFB1 (LPLUNC1), the
Lynne Bingle et al.
Respiratory research, 8, 79-79 (2007-11-09)
Short PLUNC1 (SPLUNC1) is the founding member of a family of proteins (PLUNCS) expressed in the upper respiratory tract and oral cavity, which may function in host defence. It is one of the most highly expressed genes in the upper
Loren Masterson et al.
Journal of skin cancer, 2014, 596459-596459 (2014-03-19)
Due to the rarity of Merkel cell carcinoma (MCC), prospective clinical trials have not been practical. This study aimed to identify biomarkers with prognostic significance. While sixty-two patients were identified who were treated for MCC at our institution, only seventeen

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service