Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU031921

Sigma-Aldrich

MISSION® esiRNA

targeting human BST2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCGTAGAAGATTCCAGCACCCTCCCCTAACTCCAGGCCAGACTCTAAAGGGGAGATCTGGATGGCATCTACTTCGTATGACTATTGCAGAGTGCCCATGGAAGACGGGGATAAGCGCTGTAAGCTTCTGCTGGGGATAGGAATTCTGGTGCTCCTGATCATCGTGATTCTGGGGGTGCCCTTGATTATCTTCACCATCAAGGCCAACAGCGAGGCCTGCCGGGACGGCCTTCGGGCAGTGATGGAGTGTCGCAATGTCACCCATCTCCTGCAACAAGAGCTGACCGAGGCCCAGAAGGGCTTTCAGGATGTGGAGGCCCAGGCCGCCACCTGCAACCACACTGTGATGGCCCTAATGGCTTCCCTGGATGCAGAGAAGGCCCAAGGACAAAAGAAAGTGGAGGAGCTTGAGGGAGAGATCACTACATTAAACCATAAGCTTCAGGACGCGTCTGCAGAGGTGGAGCGACTGAGAAG

Ensembl | human accession no.

ENSG00000130303

NCBI accession no.

NM_004335

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BST2(684) , BST2(684)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Eunbi Yi et al.
Biotechnology and bioengineering, 114(10), 2289-2297 (2017-05-13)
Despite all the advantages that cell-cultured influenza vaccines have over egg-based influenza vaccines, the inferior productivity of cell-culture systems is a major drawback that must be addressed. BST-2 (tetherin) is a host restriction factor which inhibits budding-out of various enveloped
Weiyu Liu et al.
Biotechnology letters, 40(7), 1015-1027 (2018-05-19)
To investigate the functional roles of bone marrow stromal cell antigen 2 (BST2) in gastric cancer (GC) cells and its implications in the development of GC patients. BST2 was frequently overexpressed in GC tissues compared with the adjacent non-tumorous tissues
Kerstin Gnirß et al.
Journal of virology, 89(18), 9178-9188 (2015-06-26)
The expression of the antiviral host cell factor tetherin is induced by interferon and can inhibit the release of enveloped viruses from infected cells. The Vpu protein of HIV-1 antagonizes the antiviral activity of tetherin, and tetherin antagonists with Vpu-like
Jérémie Prévost et al.
mBio, 10(3) (2019-06-20)
The HIV-1 accessory protein Vpu enhances viral release by counteracting the restriction factor BST-2. Furthermore, Vpu promotes NK cell evasion by downmodulating cell surface NTB-A and PVR, known ligands of the NK cell receptors NTB-A and DNAM-1, respectively. While it
Sebastian Giese et al.
PLoS pathogens, 10(7), e1004189-e1004189 (2014-07-06)
Bst-2/Tetherin inhibits the release of HIV by tethering newly formed virus particles to the plasma membrane of infected cells. Although the mechanisms of Tetherin-mediated restriction are increasingly well understood, the biological relevance of this restriction in the natural target cells
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service