Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU028201

Sigma-Aldrich

MISSION® esiRNA

targeting human NDUFA13

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTCTGGGCAAAAGAGGAGTAAAGACCCCTCAGCTGCAGCCCGGCAGCGCATTCCTACCCAGGGTCCGCCGCCAGAGCTTTCCCGCGCGGTCGGATAGTTACACTACTGTCCGGGACTTCCTAGCCGTGCCGCGGACCATCTCAAGTGCTTCCGCCACACTCATCATGGCGGTGGCAGTAAGTCACTTCCGCCCGGGACCGGAAGTGTGGGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGGGCTATGGGCCCATCGACTACAAACGGAACTTGCCGCGTCGAGGACTGTCGGGCTACAGCATGCTGGCCATAGGGATTGGAACCCTGATCTACGGGCACTGGAGCATAATGAAGTGGAACCGTGAGCGCAGGCGCCTACAAATCGAGGACTTCGAGGCTCGCATCGCGCTGTTGCCACTGTTACAGGCAGAAACCGACCGGAGGACCTTGCAGATGCTTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jung-Hee Kim et al.
Frontiers in microbiology, 8, 576-576 (2017-04-27)
Gene-associated with retinoid-interferon-induced mortality 19 (GRIM-19) targets multiple signaling pathways involved in cell death and growth. However, the role of GRIM-19 in the pathogenesis of hepatitis virus infections remains unexplored. Here, we investigated the restrictive effects of GRIM-19 on the
Yi Huang et al.
Oncotarget, 7(27), 41404-41420 (2016-05-12)
Aberrant STAT3 activation occurs in most human gastric cancers (GCs) and contributes to the malignant progression of GC, but mechanism(s) underlying aberrant STAT3 remain largely unknown. Here we demonstrated that the gene associated with retinoid interferon-induced mortality 19 (GRIM-19) was
JooYeon Jhun et al.
Cells, 10(1) (2021-01-21)
Obesity, a condition characterized by excessive accumulation of body fat, is a metabolic disorder related to an increased risk of chronic inflammation. Obesity is mediated by signal transducer and activator of transcription (STAT) 3, which is regulated by genes associated
Ping Cui et al.
Cellular signalling, 71, 109598-109598 (2020-03-14)
Recent evidence has demonstrated that the signal transducer and activator of transcription 3 (STAT3) gene are abnormally active in glioblastoma multiforme (GBM), and this change is crucial for the tumor survival and chemotherapy-resistant. Certain preclinical pharmacology studies have focused on
Na Wu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 95, 1169-1176 (2017-09-21)
The gene associated with retinoid-interferon-induced mortality-19 (GRIM-19) has been identified as a tumor suppressor in many human cancers. However, little is known about the role of GRIM-19 in cutaneous squamous cell carcinoma (CSCC). Here, we aimed to investigate the potential

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service