Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

View All Documentation

EHU018281

Sigma-Aldrich

MISSION® esiRNA

targeting human TXNRD1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAAGCCCTGCAAGACTCTCGAAATTATGGATGGAAAGTCGAGGAGACAGTTAAGCATGATTGGGACAGAATGATAGAAGCTGTACAGAATCACATTGGCTCTTTGAATTGGGGCTACCGAGTAGCTCTGCGGGAGAAAAAAGTCGTCTATGAGAATGCTTATGGGCAATTTATTGGTCCTCACAGGATTAAGGCAACAAATAATAAAGGCAAAGAAAAAATTTATTCAGCAGAGAGATTTCTCATTGCCACTGGTGAAAGACCACGTTACTTGGGCATCCCTGGTGACAAAGAATACTGCATCAGCAGTGATGATCTTTTCTCCTTGCCTTACTGCCCGGGTAAGACCCTGGTTGTTGGAGCATCCTATGTCGCTTTGGAGTGCGCTGGATTTCTTGCTGGTATTGGTTTAGACGTCACTGTTATGGTTAGGTCCATTCTTCTTAGAGGATTTGACCAGGACATGGCCAACAAAATTGGTGAACACATGGAAGAACATGGCA

Ensembl | human accession no.

ENSG00000198431

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TXNRD1(7296) , TXNRD1(7296)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bin Zhu et al.
Biochemical pharmacology, 170, 113642-113642 (2019-09-22)
Lung cancer, similar to other chronic diseases, occurs due to perturbations in multiple signaling pathways. Mono-targeted therapies are not ideal since they are not likely to be effective for the treatment and prevention of lung cancer, and are often associated
Yichong Wang et al.
Oncology reports, 37(5), 2905-2912 (2017-04-14)
Aberrant neovascularization supports nutrients and the oxygen microenvironment in tumour growth, invasion and metastasis. Recapitulation of functional microvascular structures in vitro could provide a platform for the study of vascular conditions. Sulforaphane (SFN), an isothiocyanate, has been reported to possess chemopreventive
Chuncheng Hao et al.
Oncology letters, 13(4), 2071-2078 (2017-04-30)
Radiation treatment remains one of the major modalities in the treatment of lung cancer. Although the majority of patients initially respond to treatment with radiation, resistance inevitably develops and leads to treatment failure. Therefore, the identification of the underlying molecular
Xinzhi Wang et al.
Redox biology, 24, 101153-101153 (2019-03-26)
The early immature CD34+ acute myeloid leukemia (AML) cell subpopulation-acute myeloid leukemia progenitor cells (APCs), is often resistant to conventional chemotherapy, making them largely responsible for the relapse of AML. However, to date, the eradication of APCs remains a major
Bo Ra You et al.
Molecular carcinogenesis, 53(11), 847-857 (2013-05-11)
Zebularine (Zeb) is a DNA methyltransferase (DNMT) inhibitor to that has an anti-tumor effect. Here, we evaluated the anti-growth effect of Zeb on A549 lung cancer cells in relation to reactive oxygen species (ROS) levels. Zeb inhibited the growth of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service