Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU008661

Sigma-Aldrich

MISSION® esiRNA

targeting human GADD45GIP1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTAAGCAGTTCGCGCGTTACGGCGCCGCCTCCGGGGTGGTCCCCGGTTCGTTATGGCCGTCGCCGGAGCAGCTGCGGGAGCTGGAGGCCGAAGAACGCGAATGGTACCCGAGCCTGGCGACCATGCAGGAGTCGCTGCGGGTGAAGCAGCTGGCCGAAGAGCAGAAGCGTCGGGAGAGGGAGCAGCACATCGCAGAGTGCATGGCCAAGATGCCACAGATGATTGTGAACTGGCAGCAGCAGCAGCGGGAGAACTGGGAGAAGGCCCAGGCTGACAAGGAGAGGAGGGCCCGACTGCAGGCTGAGGCCCAGGAGCTCCTGGGCTACCAGGTGGACCCAAGGAGTGCCCGCTTCCAGGAGCTGCTCCAGGACCTAGAGAAGAAGGAGCGCAAGCGCCTCAAGGAGGAAAAACAGAAACGGAAGAAGGAGGCGCGAGCTGCTGCATTGGCTGCAGCTGTGGCTCAAGACCCAGCAGCCTCTGGGGCACCCAGCTCCTGAGGCTTTGTCCCTTCCCAATAAAGCCTGCTACCTGGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Harsha Nagar et al.
Antioxidants & redox signaling, 27(4), 234-249 (2017-01-25)
Mitochondrial dysfunction has emerged as a major contributing factor to endothelial dysfunction and vascular disease, but the key mechanisms underlying mitochondrial dysfunction-induced endothelial dysfunction remain to be elucidated. In this study, we aim at determining whether mitochondrial dysfunction in endothelial
Hulin Chang et al.
Cell death & disease, 11(5), 332-332 (2020-05-10)
CR6-interacting factor 1 (Crif1) is a mitochondrial protein which is required for the assembly of oxidative phosphorylation (OXPHOS) complexes. Our bioinformatics analysis based on Cancer Genome Atlas (TCGA) database revealed an aberrant overexpression of CRIF1 in hepatocellular carcinoma (HCC). However
Shuyu Piao et al.
Biochemical and biophysical research communications, 522(4), 869-875 (2019-12-07)
Inhibition of mitochondrial protein CR6 interacting factor 1 (CRIF1) disturbs mitochondrial function, depolarizes membrane potential, and increases reactive oxygen species (ROS) levels in endothelial cells. Impaired mitochondrial function accompanied by oxidative damage is a major contributor to the initiation of
Min Joung Lee et al.
Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism, 40(7), 1546-1561 (2020-01-29)
Cerebral endothelial cells (ECs) require junctional proteins to maintain blood-brain barrier (BBB) integrity, restricting toxic substances and controlling peripheral immune cells with a higher concentration of mitochondria than ECs of peripheral capillaries. The mechanism underlying BBB disruption by defective mitochondrial
Runzhou Zhuang et al.
Oncotarget, 8(55), 94759-94768 (2017-12-08)
CR6-interacting factor 1 (CRIF1) regulates cell cycle progression and the DNA damage response. Here, we show that CRIF1 expression is decreased in hepatocellular carcinoma (HCC) tissues and positively correlates with patients' survival.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service