Skip to Content
Merck
All Photos(1)

Key Documents

EHU001181

Sigma-Aldrich

MISSION® esiRNA

targeting human SOCS2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCGCACTGACTTCAAGGAAGGACGCGAACCCTTCTCTGACCCCAGCTCGGGCGGCCACCTGTCTTTGCCGCGGTGACCCTTCTCTCATGACCCTGCGGTGCCTTGAGCCCTCCGGGAATGGCGGGGAAGGGACGCGGAGCCAGTGGGGGACCGCGGGGTCGGCGGAGGAGCCATCCCCGCAGGCGGCGCGTCTGGCGAAGGCCCTGCGGGAGCTCGGTCAGACAGGATGGTACTGGGGAAGTATGACTGTTAATGAAGCCAAAGAGAAATTAAAAGAGGCACCAGAAGGAACTTTCTTGATTAGAGATAGCTCGCATTCAGACTACCTACTAACAATATCTGTTAAAACATCAGCTGGACCAACTAATCTTCGAATCGAATACCAAGACGGAAAATTCAGATTGGACTCTATCATATGTGTCAAATCCAAGCTTAAACAATTTGACAGTGTGGTTCATCTGATCGACTACTATGTTCAGATGTGCAAGGATAAGCGGACAGGTCCAGAAGCCCCCCGGAACGGCACTGTTCACCTTTATCTGACCAAACCGCTCTACACGTCAGCACCATCTCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fang Wang et al.
Journal of biomedical science, 28(1), 4-4 (2021-01-06)
Circular RNAs (circRNAs) have caught increasing attentions and interests for their important involvement in cancer initiation and progression. This study aims to investigate the biological functions of circNOL10 and its potential molecular mechanisms in breast cancer (BC). qRT-PCR and western
Jihao Xu et al.
Oncology reports, 44(3), 973-986 (2020-07-25)
N6‑methyladenosine (m6A) RNA modification maintained by N6‑methyltransferases and demethylases is involved in multiple biological functions. Methyltransferase like 3 (METTL3) is a major N6‑methyltransferase. However, the role of METTL3 and its installed m6A modification in colorectal tumorigenesis remains to be fully
Haichun Ouyang et al.
International immunopharmacology, 81, 106204-106204 (2020-02-23)
Accumulating evidence has revealed the roles of microRNAs (miRs) in sepsis, hence, the aim of the present study was to investigate whether miR-208a-5p affects sepsis whilst attempting to elucidate the mechanisms by which the suppressors of cytokine signaling 2 (SOCS2)-mediated

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service