Skip to Content
Merck
All Photos(1)

Documents

EMU053261

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rapgef3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTCTTTGAACCACACAGCAAGGCAGGAACTGTGTTGTTCAGCCAGGGGGACAAGGGTACCTCGTGGTACATTATCTGGAAGGGATCTGTCAATGTGGTGACCCATGGCAAGGGGCTGGTGACCACGTTGCACGAGGGAGATGACTTTGGACAGCTGGCTCTGGTGAACGACGCACCTCGGGCAGCCACCATCATCCTTCGAGAAAATAACTGTCACTTTCTGCGTGTGGACAAGCAGGACTTCAACCGCATCATCAAGGATGTGGAAGCAAAAACCATGAGACTGGAAGAACACGGCAAAGTGGTCTTAGTTCTGGAGAGAACCTCTCAGGGTGCTGGCCCTTCCCGTCCCCCGACCCCAGGCAGGAACCGGTATACGGTCATGTCTGGCACCCCAGAGAAAATCCTAGAACTGCTGTTGGAGGCTATGAGACCGGATTCCAGTGCTCATGACCCAACAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Andrea Heldsinger et al.
Endocrinology, 155(10), 3956-3969 (2014-07-26)
The anorexigenic adipocyte-derived hormone leptin and the orexigenic hormone ghrelin act in opposition to regulate feeding behavior via the vagal afferent pathways. The mechanisms by which ghrelin exerts its inhibitory effects on leptin are unknown. We hypothesized that ghrelin activates
Kazuya Kusama et al.
Reproduction (Cambridge, England), 147(6), 897-906 (2014-03-04)
The optimal decidualization of endometrial stromal cells (ESCs) following embryo implantation is one of the critical steps to establish pregnancy in rodents and humans. This step is intricately regulated by ovarian hormones. Using in vitro human ESCs model, we previously
Supachoke Mangmool et al.
Molecular endocrinology (Baltimore, Md.), 29(4), 583-596 (2015-02-27)
Although the cardioprotective effects of glucagon-like peptide-1 and its analogs have been reported, the exact mechanisms of the glucagon-like peptide-1 receptor (GLP-1R) signaling pathway in the heart are still unclear. Activation of the GLP-1R has been shown to increase cAMP
Ke Ke et al.
PloS one, 10(5), e0124869-e0124869 (2015-05-21)
Cilostazol has been reported to alleviate the metabolic syndrome induced by increased intracellular adenosine 3',5'-cyclic monophosphate (cAMP) levels, which is also associated with osteoclast (OC) differentiation. We hypothesized that bone loss might be attenuated via an action on OC by
Pablo Muñoz-Llancao et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(32), 11315-11329 (2015-08-14)
Acquisition of neuronal polarity is a complex process involving cellular and molecular events. The second messenger cAMP is involved in axonal specification through activation of protein kinase A. However, an alternative cAMP-dependent mechanism involves the exchange protein directly activated by

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service