Skip to Content
Merck
All Photos(1)

Documents

EMU033531

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gabpa

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCAGTGTTCTTTGGATGCTCATGAAATTTGCCTGCAAGATATTCAGCTGGATCCAGACCGAAGCTTGTTTGATCAAGGAGTGAAAACAGATGGGACTGTACAGCTTAGTGTACAGGTAATTTCTTACCAAGGAATGGAGCCAAAGTTGAACATTCTTGAAATTGTTAAGACTGCGGAAACGGTCGAGGTGGTCATCGATCCAGATGCCCACCACGCGGAAGCAGAAGCGCATCTCGTTGAAGAAGCTCAAGTGATAACTCTTGACGGCACCAAGCACATTACGACCATTTCAGACGAGACCTCGGAGCAGGTGACGAGATGGGCTGCTGCACTGGAAGGCTACAGAAAAGAGCAGGAGCGCCTTGGCATCCCCTATGATCCTATACACTGGTCCACGGACCAAGTCCTGCATTGGGTGGTTTGGGTAATGAAGGAGTTCAGCATGACTGATATAGACCTCACCACACTCAACATTTCGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bo-hyun Choi et al.
PloS one, 9(9), e107158-e107158 (2014-09-17)
Photodynamic therapy (PDT) has emerged as an effective treatment for various solid tumors. The transcription factor NRF2 is known to protect against oxidative and electrophilic stress; however, its constitutive activity in cancer confers resistance to anti-cancer drugs. In the present
Laura Gambari et al.
Pharmacological research, 87, 99-112 (2014-07-08)
Hydrogen sulfide (H2S), which recently emerged as a potent regulator of tissues and organs, is broadly produced in mammalian cells but whether it can regulate bone cell function is still elusive. The main objective of this study was to establish
Hitoshi Murata et al.
PloS one, 10(11), e0142438-e0142438 (2015-11-12)
Mutations of the PTEN-induced putative kinase 1 (PINK1) gene are a cause of autosomal recessive forms of Parkinson's disease. Recent studies have revealed that PINK1 is an essential factor for controlling mitochondrial quality, and that it protects cells from oxidative

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service