Skip to Content
Merck
All Photos(1)

Documents

EMU016021

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Smad4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACAAGGTGGGGAAAGTGAAACCTTTGCAAAAAGAGCAATTGAGAGTTTGGTAAAGAAGCTGAAAGAGAAAAAAGATGAATTGGATTCTTTAATAACAGCTATAACTACAAATGGAGCTCATCCTAGCAAGTGTGTCACCATACAGAGAACATTGGATGGACGACTTCAGGTGGCTGGTCGGAAAGGATTTCCTCATGTGATCTATGCCCGTCTGTGGAGGTGGCCTGATCTACACAAGAATGAACTAAAGCATGTTAAATATTGTCAGTATGCGTTTGACTTAAAATGTGACAGTGTCTGTGTGAATCCATATCACTATGAGCGGGTTGTCTCACCTGGAATTGATCTCTCAGGATTAACACTGCAGAGTAATGCTCCAAGTATGTTAGTGAAGGATGAGTACGTTCACGACTTTGAAGGACAGCCGTC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ri Youn Kim et al.
Tissue engineering. Part A, 21(13-14), 2076-2088 (2015-04-04)
Clinical data show that estrogen levels are inversely associated with the production of sclerostin, a Wnt antagonist that recently attracted great attention over the use of its antibody in the anabolic treatment of osteoporotic conditions. However, the molecular link between
Jennifer C Bailey et al.
Immunology, 143(4), 679-691 (2014-07-06)
CD1d-mediated lipid antigen presentation activates a subset of innate immune lymphocytes called invariant natural killer T (NKT) cells that, by virtue of their potent cytokine production, bridge the innate and adaptive immune systems. Transforming growth factor (TGF-β) is a known
Kwangho Kim et al.
Molecular and cellular biochemistry, 407(1-2), 143-149 (2015-06-07)
Bioflavonoids are known to induce cardioprotective effects by inhibiting vascular smooth muscle cell (VSMC) proliferation and migration. Kaempferol has been shown to inhibit VSMC proliferation. However, little is known about the effect of kaempferol on VSMC migration and the underlying

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service