Skip to Content
Merck
All Photos(1)

Documents

EHU138141

Sigma-Aldrich

MISSION® esiRNA

targeting human XRCC3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCAGAGTGCAAGAGATGCCTCAGTCAAGTCAGCCAAAAACACGCGGGTCATCCCCAAGCCCCAGAGAGTGACAGAGCCCCGATGACACGGACACCTCGGCTGCTGTCACTTCCCTGGTTCGGGCCTCCCACAGGCTTTGAATTGAAGGCGAGTGCCTCAGAATTTGCATCCATTGTTCTGTCTTTCCTGGGAAGTTATTCATCCTGGTGGCCAGCCCACCGACAAAATGGATTTGGATCTACTGGACCTGAATCCCAGAATTATTGCTGCAATTAAGAAAGCCAAACTGAAATCGGTAAAGGAGGTTTTACACTTTTCTGGACCAGACTTGAAGAGACTGACCAACCTCTCCAGCCCCGAGGTCTGGCACTTGCTGAGAACGGCCTCCTTACACTTGCGGGGAAGCAGCATCCTTACAGCACTGCAGCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wynand P Roos et al.
Cancer letters, 424, 119-126 (2018-03-27)
Glioblastoma is the most frequent and aggressive form of high-grade malignant glioma. Due to the dismal prognosis faced by patients suffering from this disease, there is a need for identifying new targets that might improve therapy. The aim of this
Ramon Lopez Perez et al.
Radiotherapy and oncology : journal of the European Society for Therapeutic Radiology and Oncology, 133, 77-86 (2019-04-03)
Carbon ion radiotherapy is a promising therapeutic option for glioblastoma patients due to its high physical dose conformity and greater biological effectiveness than photons. However, the biological effects of carbon ion radiation are still incompletely understood. Here, we systematically compared
Jo-Fan Chang et al.
Toxicological sciences : an official journal of the Society of Toxicology, 139(2), 396-406 (2014-03-29)
The nucleus is a key organelle in mammary cells, which is responsible for several cellular functions including cell proliferation, gene expression, and cell survival. In addition, the nucleus is the primary targets of doxorubicin treatment. In the current study, low-abundance
Marco Agostini et al.
Cancer biology & therapy, 16(8), 1160-1171 (2015-05-30)
Preoperative chemoradiotherapy is widely used to improve local control of disease, sphincter preservation and to improve survival in patients with locally advanced rectal cancer. Patients enrolled in the present study underwent preoperative chemoradiotherapy, followed by surgical excision. Response to chemoradiotherapy

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service