Skip to Content
Merck
All Photos(1)

Key Documents

EHU133481

Sigma-Aldrich

MISSION® esiRNA

targeting human TMEM173

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATATCTGCGGCTGATCCTGCCAGAGCTCCAGGCCCGGATTCGAACTTACAATCAGCATTACAACAACCTGCTACGGGGTGCAGTGAGCCAGCGGCTGTATATTCTCCTCCCATTGGACTGTGGGGTGCCTGATAACCTGAGTATGGCTGACCCCAACATTCGCTTCCTGGATAAACTGCCCCAGCAGACCGGTGACCATGCTGGCATCAAGGATCGGGTTTACAGCAACAGCATCTATGAGCTTCTGGAGAACGGGCAGCGGGCGGGCACCTGTGTCCTGGAGTACGCCACCCCCTTGCAGACTTTGTTTGCCATGTCACAATACAGTCAAGCTGGCTTTAGCCGGGAGGATAGGCTTGAGCAGGCCAAACTCTTCTGCCGGACACTTGAGGACATCCTGGCAGATGCCCCTGAGTCTCAGAACAACTGCCGCCTCATTGCCTACCAGGAACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Li Zhou et al.
Cancer letters, 500, 163-171 (2020-12-06)
Although the combination of chemotherapy and immunotherapy is a hot topic in lung cancer, little is understood regarding the possible mechanisms behind their synergy. Moreover, safety is a major concern for clinicians while performing chemotherapy. Therefore, it is important to
Marcin Gamdzyk et al.
Molecular neurobiology, 57(6), 2600-2619 (2020-04-08)
cGAS is a sensor of cytosolic DNA and responds equally to exogenous and endogenous DNA. After recognition of cytosolic dsDNA or ssDNA, cGAS synthesizes the second messenger 2'3'-cGAMP, which then binds to and activates stimulator of interferon genes (STING). STING
Junxia Cui et al.
Fish & shellfish immunology, 68, 29-36 (2017-07-08)
In the innate immune responses in host protection, pattern recognition receptors are involve in a variety of sensing mechanisms to recognize and counter pathogen invasion. Recently, a resident endoplasmic reticulum adaptor, stimulator of interferon genes (STING) protein, also called MPYS
Jin-Shan Ran et al.
International journal of molecular sciences, 19(12) (2018-11-25)
Innate immunity is an essential line of defense against pathogen invasion which is gained at birth, and the mechanism involved is mainly to identify pathogen-associated molecular patterns through pattern recognition receptors. STING (stimulator of interferon genes) is a signal junction
Yin Wu et al.
Biochemical and biophysical research communications, 546, 138-144 (2021-02-15)
Hepatic injury is common in patients who suffer from severe burns plus delayed resuscitation (B + DR). Stimulator of interferon genes (STING) is primarily expressed in Kupffer cells (KCs). We demonstrated that B + DR caused hepatic injury and oxidative stress. Reactive oxygen species

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service