Skip to Content
Merck
All Photos(1)

Documents

EHU130921

Sigma-Aldrich

MISSION® esiRNA

targeting human TGFBI

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCACCAACAACATCCAGCAGATCATTGAGATCGAGGACACCTTTGAGACCCTTCGGGCTGCTGTGGCTGCATCAGGGCTCAACACGATGCTTGAAGGTAACGGCCAGTACACGCTTTTGGCCCCGACCAATGAGGCCTTCGAGAAGATCCCTAGTGAGACTTTGAACCGTATCCTGGGCGACCCAGAAGCCCTGAGAGACCTGCTGAACAACCACATCTTGAAGTCAGCTATGTGTGCTGAAGCCATCGTTGCGGGGCTGTCTGTAGAGACCCTGGAGGGCACGACACTGGAGGTGGGCTGCAGCGGGGACATGCTCACTATCAACGGGAAGGCGATCATCTCCAATAAAGACATCCTAGCCACCAACGGGGTGATCCACTACATTGATGAGCTACTCATCCCAGACTCAGCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Huan He et al.
Oncogene, 37(19), 2586-2600 (2018-02-23)
A critical mechanism that has been proposed for transcription regulation by estrogen receptor α (ER) is the tethering of ER to DNA via other transcription factors, such as AP-1. However, genome-wide assessment of the overlap in chromatin binding repertoires of
Bingyan Li et al.
BMC cancer, 12, 239-239 (2012-06-15)
Transforming growth factor β induced (TGFBI) product, an extracellular matrix (ECM) protein, has been implicated as a putative tumor suppressor in recent studies. Our previous findings revealed that expression of TGFBI gene is down-regulated in a variety of cancer cell
Tianhong Pan et al.
Neoplasia (New York, N.Y.), 20(1), 32-43 (2017-12-01)
Bone metastasis is common in renal cell carcinoma (RCC), and the lesions are mainly osteolytic. The mechanism of bone destruction in RCC bone metastasis is unknown. We used a direct intrafemur injection of mice with bone-derived 786-O RCC cells (Bo-786)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service