Skip to Content
Merck
All Photos(1)

Documents

EHU092161

Sigma-Aldrich

MISSION® esiRNA

targeting human ANTXR1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCACCACTGGAATGAAATCTATTACTTTGTGGAACAGTTGGCTCACAAATTCATCAGCCCACAGTTGAGAATGTCCTTTATTGTTTTCTCCACCCGAGGAACAACCTTAATGAAACTGACAGAAGACAGAGAACAAATCCGTCAAGGCCTAGAAGAACTCCAGAAAGTTCTGCCAGGAGGAGACACTTACATGCATGAAGGATTTGAAAGGGCCAGTGAGCAGATTTATTATGAAAACAGACAAGGGTACAGGACAGCCAGCGTCATCATTGCTTTGACTGATGGAGAACTCCATGAAGATCTCTTTTTCTATTCAGAGAGGGAGGCTAATAGGTCTCGAGATCTTGGTGCAATTGTTTACTGTGTTGGTGTGAAAGATTTCAATGAGACACAGCTGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Cai-Xia Wang et al.
American journal of translational research, 12(7), 3557-3576 (2020-08-11)
Tumor endothelial cell marker 8 (TEM8) is a type I transmembrane protein, that has been widely studied in the areas of anthrax toxin infection and tumor angiogenesis. However, the role of TEM8 in the progression of epithelial ovarian cancer (EOC)
Amit Kumar et al.
PloS one, 9(6), e100228-e100228 (2014-06-28)
The Kaposi's sarcoma-associated herpesvirus infects the human population and maintains latency stage of viral life cycle in a variety of cell types including cells of epithelial, mesenchymal and endothelial origin. The establishment of latent infection by KSHV requires the expression
Maude Gabriel et al.
BMC cancer, 15, 227-227 (2015-04-18)
Modification of splicing by chemotherapeutic drugs has usually been evaluated on a limited number of pre-mRNAs selected for their recognized or potential importance in cell proliferation or apoptosis. However, the pathways linking splicing alterations to the efficiency of cancer therapy

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service