Skip to Content
Merck
All Photos(1)

Key Documents

EHU068851

Sigma-Aldrich

MISSION® esiRNA

targeting human ASAP1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTGAGGCCATCAAATCCAGGGATTTACTTGCACTAATTCAAGTCTATGCAGAAGGGGTAGAGCTAATGGAACCACTGCTGGAACCTGGGCAGGAGCTTGGGGAGACAGCCCTTCACCTTGCCGTCCGAACTGCAGATCAGACATCTCTCCATTTGGTTGACTTCCTTGTACAAAACTGTGGGAACCTGGATAAGCAGACGGCCCTGGGAAACACAGTTCTACACTACTGTAGTATGTACAGTAAACCTGAGTGTTTGAAGCTTTTGCTCAGGAGCAAGCCCACTGTGGATATAGTTAACCAGGCTGGAGAAACTGCCCTAGACATAGCAAAGAGACTAAAAGCTACCCAGTGTGAAGATCTGCTTTCCCAGGCTAAATCTGGAAAGTTCAATCCACACGTCCACGTAGAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Anjelika Gasilina et al.
iScience, 22, 166-180 (2019-12-01)
ASAP1 is a multi-domain ArfGAP that controls cell migration, spreading, and focal adhesion dynamics. Although its GAP activity contributes to remodeling of the actin cytoskeleton, it does not fully explain all cellular functions of ASAP1. Here we find that ASAP1
Jia Cui et al.
Frontiers in cellular and infection microbiology, 10, 519503-519503 (2020-11-17)
The ADP ribosylation factor (ARF) GTPase activation protein ASAP1 possesses multiple biological functions, including regulation of cytoskeletal dynamics, small GTP-binding protein receptor recycling, and intracellular vesicle trafficking. Recently, ASAP1 polymorphisms have been reported to be associated with human susceptibility to
Sheroy Minocherhomji et al.
Nature, 528(7581), 286-290 (2015-12-04)
Oncogene-induced DNA replication stress has been implicated as a driver of tumorigenesis. Many chromosomal rearrangements characteristic of human cancers originate from specific regions of the genome called common fragile sites (CFSs). CFSs are difficult-to-replicate loci that manifest as gaps or

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service