Skip to Content
Merck
All Photos(1)

Documents

EHU037121

Sigma-Aldrich

MISSION® esiRNA

targeting human CA9

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACTCCTGCCCTCTGACTTCAGCCGCTACTTCCAATATGAGGGGTCTCTGACTACACCGCCCTGTGCCCAGGGTGTCATCTGGACTGTGTTTAACCAGACAGTGATGCTGAGTGCTAAGCAGCTCCACACCCTCTCTGACACCCTGTGGGGACCTGGTGACTCTCGGCTACAGCTGAACTTCCGAGCGACGCAGCCTTTGAATGGGCGAGTGATTGAGGCCTCCTTCCCTGCTGGAGTGGACAGCAGTCCTCGGGCTGCTGAGCCAGTCCAGCTGAATTCCTGCCTGGCTGCTGGTGACATCCTAGCCCTGGTTTTTGGCCTCCTTTTTGCTGTCACCAGCGTCGCGTTCCTTGTGCAGATGAGAAGGCAGCACAGAAGGGGAACCAAAGGGGGTGTGAGCTACCGCCCAGCAGAGGTAGCCGAGACTGGAGCCTAGAGGCTGGATCTTGGAGAATGTGAGAAGCCAGC

Ensembl | human accession no.

ENSG00000107159

NCBI accession no.

NM_001216

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CA9(768) , CA9(768)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Martin Benej et al.
Frontiers in oncology, 10, 1462-1462 (2020-09-29)
Tumor hypoxia represents a severe microenvironmental stress that is frequently associated with acidosis. Cancer cells respond to these stresses with changes in gene expression that promote survival at least in part through pH regulation and metabolic reprogramming. Hypoxia-induced carbonic anhydrase
Min-Chieh Hsin et al.
Cancers, 13(5) (2021-04-04)
Carbonic anhydrase IX (CAIX) is a hypoxia-induced protein that is highly expressed in numerous human cancers. However, the molecular mechanisms involved in CAIX and human cervical cancer metastasis remain poorly understood. In this study, CAIX overexpression in SiHa cells increased
Kuo-Tai Hua et al.
Scientific reports, 7(1), 4466-4466 (2017-07-02)
Carbonic anhydrase IX (CA9) expression level has been considered as a poor prognostic factor in hepatocellular carcinoma (HCC) patients. However, the judging criteria of CA9 level is hard to define for potential clinical applications. Unlike CA9 expression level, CA9 polymorphism
Somayeh Jamali et al.
Scientific reports, 5, 13605-13605 (2015-09-05)
The most aggressive tumour cells, which often reside in hypoxic environments, rely on glycolysis for energy production. Thereby they release vast amounts of lactate and protons via monocarboxylate transporters (MCTs), which exacerbates extracellular acidification and supports the formation of a

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service