Skip to Content
Merck
All Photos(1)

Documents

EHU016271

Sigma-Aldrich

MISSION® esiRNA

targeting human JAM3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAATGACCGCAAGGAAATTGATGAGATTGTGATCGAGTTAACTGTGCAAGTGAAGCCAGTGACCCCTGTCTGTAGAGTGCCGAAGGCTGTACCAGTAGGCAAGATGGCAACACTGCACTGCCAGGAGAGTGAGGGCCACCCCCGGCCTCACTACAGCTGGTATCGCAATGATGTACCACTGCCCACGGATTCCAGAGCCAATCCCAGATTTCGCAATTCTTCTTTCCACTTAAACTCTGAAACAGGCACTTTGGTGTTCACTGCTGTTCACAAGGACGACTCTGGGCAGTACTACTGCATTGCTTCCAATGACGCAGGCTCAGCCAGGTGTGAGGAGCAGGAGATGGAAGTCTATGACCTGAACATTGGCGGAATTATTGGGGGGGTTCTGGTTGTCCTTGCTGTACTGGCCCTGATCACGTTGGGCATCTGCTGTGCATACAGACGTGGCTACTTCATCAACAATAAACAGGATGGAGAAAGTTACAAGAACCCAGGGAAACCAGAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xudong Li et al.
International journal of molecular medicine, 42(5), 2923-2929 (2018-09-19)
As a common type of renal cancer, renal cell carcinoma (RCC) has a high annual mortality rate. The incidence of RCC has been increasing in China and worldwide. A large number cases of RCC are diagnosed at late stages, often
SongNan Hao et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(6), 5675-5687 (2014-03-04)
This study aims to investigate lymphatic metastasis-related genes in non-small cell lung carcinomas (NSCLC). NSCLC tissue was analyzed for expression of junctional adhesion molecule-C (JAM-C) protein. Our data revealed novel associations between JAM-C overexpression in primary tumors and lymphatic microvessel
Matina Economopoulou et al.
Thrombosis and haemostasis, 114(6), 1241-1249 (2015-08-28)
In proliferative retinopathies, like proliferative diabetic retinopathy and retinopathy of prematurity (ROP), the hypoxia response is sustained by the failure of the retina to revascularise its ischaemic areas. Non-resolving retina ischaemia/hypoxia results in upregulation of pro-angiogenic factors and pathologic neovascularisation

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service