Skip to Content
Merck
All Photos(1)

Key Documents

EHU014711

Sigma-Aldrich

MISSION® esiRNA

targeting human A4GALT

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATCATCGGCTTCAAGTTCACGTTTTTCGTCTCCATCATGATCTACTGGCACGTTGTGGGAGAGCCCAAGGAGAAAGGGCAGCTCTATAACCTGCCAGCAGAGATCCCCTGCCCCACCTTGACACCCCCCACCCCACCCTCCCACGGCCCCACTCCAGGCAACATCTTCTTCCTGGAGACTTCAGACCGGACCAACCCCAACTTCCTGTTCATGTGCTCGGTGGAGTCGGCCGCCAGAACTCACCCCGAATCCCACGTGCTGGTCCTGATGAAAGGGCTTCCGGGTGGCAACGCCTCTCTGCCCCGGCACCTGGGCATCTCACTTCTGAGCTGCTTCCCGAATGTCCAGATGCTCCCGCTGGACCTGCGGGAGCTGTTCCGGGACACACCCCTGGCCGACTGGTACGCGGCCGTGCAGGGGCGCTGGGAGCCCTACCTGCTGCCCGTGCTCTCCGACGCCTCCAGGATCGCACTCATGTGGAAGTTCGGCGGCATCTACCTGGACACGGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Karl Johansson et al.
Frontiers in cellular and infection microbiology, 10, 212-212 (2020-06-12)
Shiga toxin is the main virulence factor of non-invasive enterohemorrhagic Escherichia coli strains capable of causing hemolytic uremic syndrome. Our group has previously shown that the toxin can reach the kidney within microvesicles where it is taken up by renal
Shigeki Sugawara et al.
Glycoconjugate journal, 34(1), 127-138 (2016-11-01)
Silurus asotus egg lectin (SAL), an α-galactoside-binding protein isolated from the eggs of catfish, is a member of the rhamnose-binding lectin family that binds to Gb3 glycan (Galα1-4Galβ1-4Glc). We have previously demonstrated that SAL reduces the proliferation of Gb3-expressing Burkitt's
Jonas Bergan et al.
Cellular and molecular life sciences : CMLS, 71(21), 4285-4300 (2014-04-18)
Shiga toxin-producing Escherichia coli bacteria cause hemorrhagic colitis and hemolytic uremic syndrome in humans. Currently, only supportive treatment is available for diagnosed patients. We show here that 24-h pretreatment with an ether lipid precursor, the alkylglycerol sn-1-O-hexadecylglycerol (HG), protects HEp-2

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service