Skip to Content
Merck
All Photos(1)

Key Documents

EHU001951

Sigma-Aldrich

MISSION® esiRNA

targeting human REL

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCCATCTCAAGTGGATTGTCACATCATGCCTCAATGGCACCTCTGCCTTCTTCAAGCTGGTCATCAGTGGCCCACCCCACCCCACGCTCAGGCAATACAAACCCACTGAGTAGTTTTTCAACAAGGACACTTCCTTCTAATTCGCAAGGTATCCCACCATTCCTGAGAATACCTGTTGGGAATGATTTAAATGCTTCTAATGCTTGCATTTACAACAATGCCGATGACATAGTCGGAATGGAAGCGTCATCCATGCCATCAGCAGATTTATATGGTATTTCTGATCCCAACATGCTGTCTAATTGTTCTGTGAATATGATGACAACCAGCAGTGACAGCATGGGAGAGACTGATAATCCAAGACTTCTGAGCATGAATCTTGAAAACCCCTCATGTAATTCAGTGTTAGACCCAAGAGACTTGAGACAGCTCCATCAGATGTCCTCTTCCAGTATGTCAGCAGGCGCCAATTCCAATACTACTGTTTTTGTTTCACAATCAGATGCATTTGAGGGATCTGACTTCAGTTGTGCAGATAACAGCATGATAAATGAGTCGGGACCATCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Seyedeh Momeneh Mohammadi et al.
Leukemia research, 61, 53-61 (2017-09-12)
The c-Rel transcription factor is a unique member of the NF-kB family that has a role in apoptosis, proliferation and cell survival. Overexpression of c-Rel is detected in many human B cell tumors, including B-cell leukemia and several cancers. The
Xiaodong Lai et al.
Oncology reports, 36(6), 3651-3656 (2016-10-26)
miR‑574‑5p has been reported involved in the pathogenesis of numerous human malignancies such as colorectal and lung cancer. In this study, we aimed to explore the roles of REL and miR‑574 in the recurrence of prostate cancer (PCa) and to identify
Shayna E Thomas-Jardin et al.
The Prostate, 80(2), 133-145 (2019-11-16)
The androgen receptor (AR) nuclear transcription factor is a therapeutic target for prostate cancer (PCa). Unfortunately, patients can develop resistance to AR-targeted therapies and progress to lethal disease, underscoring the importance of understanding the molecular mechanisms that underlie treatment resistance.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service