Skip to Content
Merck
All Photos(1)

Documents

EHU001891

Sigma-Aldrich

MISSION® esiRNA

targeting human INCENP

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACCTGCTGGAGCTATGTGACCAGAAGCTCATGGAGTTTCTCTGCAACATGGATAATAAGGACTTGGTGTGGCTTGAGGAAATCCAAGAGGAGGCCGAGCGCATGTTCACCAGAGAATTCAGCAAAGAGCCAGAGCTGATGCCCAAAACACCTTCTCAGAAGAACCGACGGAAGAAGAGACGGATTTCTTATGTTCAGGATGAAAACAGAGATCCCATCAGGAGAAGGTTATCCCGCAGAAAGTCTCGGAGCAGCCAGCTGAGCTCCCGACGCCTCCGCAGCAAGGACAGTGTAGAGAAGCTGGCTACAGTGGTCGGGGAGAACGGCTCCGTCCTGCGGCGTGTGACCCGTGCTGCGGCTGCAGCTGCCGCGGCTACCATGGCATTGGCTGCACCTTCTTCACCCACCCCTGAGTCTCCCACGATGCTGACTAAGAAGCCCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Andrius Serva et al.
PloS one, 7(12), e52555-e52555 (2013-01-04)
miRNA cluster miR-17-92 is known as oncomir-1 due to its potent oncogenic function. miR-17-92 is a polycistronic cluster that encodes 6 miRNAs, and can both facilitate and inhibit cell proliferation. Known targets of miRNAs encoded by this cluster are largely
Keith F DeLuca et al.
The Journal of cell biology, 217(1), 163-177 (2017-12-01)
Precise regulation of kinetochore-microtubule attachments is essential for successful chromosome segregation. Central to this regulation is Aurora B kinase, which phosphorylates kinetochore substrates to promote microtubule turnover. A critical target of Aurora B is the N-terminal "tail" domain of Hec1
Ming Sun et al.
Cancer research, 79(19), 4937-4950 (2019-08-17)
Chromosomal passenger complex (CPC) has been demonstrated to be a potential target of cancer therapy by inhibiting Aurora B or survivin in different types of cancer including neuroblastoma. However, chemical inhibition of either Aurora B or survivin does not target

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service