Skip to Content
Merck
All Photos(1)

Key Documents

EHU091111

Sigma-Aldrich

MISSION® esiRNA

targeting human UBE2K

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCGCACGGTATTATTGTCATTGCAAGCACTATTGGCAGCTGCAGAGCCAGATGATCCACAGGATGCTGTAGTAGCAAATCAGTACAAACAAAATCCCGAAATGTTCAAACAGACAGCTCGACTTTGGGCACATGTGTATGCTGGAGCACCAGTTTCTAGTCCAGAATACACCAAAAAAATAGAAAACCTATGTGCTATGGGCTTTGATAGGAATGCAGTAATAGTGGCCTTGTCTTCAAAATCATGGGATGTAGAGACTGCAACAGAATTGCTTCTGAGTAACTGAGGCATAGAGAGCTGCTGATATAGTCAAGCTTGCCTCTTCTTGAGGAGCACCAACATCTGTTATTTTTAGGATTCTGCATAGATTTCTTTTAAACTGGCATTCTTGCCTAATGATGTTATCTAGGCACCATTGGAGACTG

Ensembl | human accession no.

ENSG00000078140

NCBI accession no.

NM_005339

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... UBE2K(3093) , UBE2K(3093)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Eun Il Jeong et al.
Cell death & disease, 7(12), e2573-e2573 (2016-12-30)
Cerebral ischemia/reperfusion (I/R) causes brain damage accompanied by ubiquitin accumulation and impairment of proteasome activity. In this study, we report that E2-25K, an E2-conjugating enzyme, is SUMOylated during oxidative stress and regulates cerebral I/R-induced damage. Knockdown of E2-25K expression protects
Lisa Schmölz et al.
Biochimica et biophysica acta, 1863(8), 919-927 (2018-05-08)
The long-chain metabolites of vitamin E (LCM) emerge as a new class of regulatory metabolites and have been considered as the active compounds formed during vitamin E metabolism. The bioactivity of the LCM is comparable to the already established role
Wen-Bin Gu et al.
Developmental and comparative immunology, 101, 103452-103452 (2019-07-19)
NFIL3 is a transcriptional activator of the IL-3 promoter in T cells. In vertebrates, it has been characterized as an essential regulator of several cellular processes such as immunity response, apoptosis and NK cells maturation. However, the identification and functional

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service