Skip to Content
Merck
All Photos(1)

Key Documents

EMU070971

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tmsb4x

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€231.00
50 μG
€411.00

€231.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
€231.00
50 μG
€411.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€231.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAAACCCGATATGGCTGAGATCGAGAAATTCGATAAGTCGAAGTTGAAGAAAACAGAAACGCAAGAGAAAAATCCTCTGCCTTCAAAAGAAACAATTGAACAAGAGAAGCAAGCTGGCGAATCGTAATGAGGCGAGCGCCGCCAATATGCACTGTACATTCCACGAGCATTGCCTTCTTATTTTACTTCTTTTAGCTGTTTAACTTTGTAAGATGCAAAGAGGTTGGATCAAGTTTAAATGACTGTGCTGCCCCTTTCACATCAAAGAATCAGAACTACTGAGCAGGAAGGCCTCCCCTGCCTCTCCCACCCATCTGATGGTCTGGCTAGCAGAGAGGGAAAAGAACTTGCATGTTGGTGAAGGAAAAAGCTGGGTGGGAGATGATGAAATAGAGAGGAAAATTCAACATGGTCAAAGATGTCCTGCAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tamotsu Kiyoshima et al.
Stem cell research, 12(1), 309-322 (2013-12-18)
Previous studies have shown that the recombination of cells liberated from developing tooth germs develop into teeth. However, it is difficult to use human developing tooth germ as a source of cells because of ethical issues. Previous studies have reported
Bin Dong et al.
Atherosclerosis, 235(2), 449-462 (2014-06-21)
CETP inhibitors block the transfer of cholesteryl ester from HDL-C to VLDL-C and LDL-C, thereby raising HDL-C and lowering LDL-C. In this study, we explored the effect of CETP inhibitors on hepatic LDL receptor (LDLR) and PCSK9 expression and further

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service