Skip to Content
Merck
All Photos(1)

Key Documents

EMU063671

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Apmap

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€231.00
50 μG
€411.00

€231.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
€231.00
50 μG
€411.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€231.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGAGGGCAAGAAGATGTCCTTTGTGAATGACCTCACTGTTACTCGGGATGGAAGGAAGATTTATTTCACGGATTCCAGCAGCAAGTGGCAGAGACGAGACTACCTGCTTCTGGTGATGGAGGCCACTGATGATGGGCGCCTGTTAGAGTATGATACTGTGACGAAAGAAGTGAAGGTTTTGTTGGACCAGTTGCAGTTCCCTAATGGAGTTCAGCTCTCTCCTGAGGAAGACTTTGTCCTAGTGGCAGAGACAACTATGGCCAGGATACGAAGAGTCTATGTGTCTGGCCTGATGAAAGGAGGGGCAGATATGTTTGTGGAGAACATGCCTGGATTTCCTGACAATATCCGGCCTAGCAGCTCTGGCGGATACTGGGTTGCTGCTGCAACCATTCGTGCTAACCCTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yuhang Ma et al.
Journal of proteome research, 15(2), 628-637 (2016-01-16)
Gestational diabetes mellitus (GDM) is considered as an early stage of type 2 diabetes mellitus. In this study, we compared demographic and clinical data between six GDM subjects and six normal glucose tolerance (NGT; healthy controls) subjects and found that
Sebastien Mosser et al.
Human molecular genetics, 24(2), 371-382 (2014-09-03)
The deposition of amyloid-beta (Aβ) aggregates in the brain is a major pathological hallmark of Alzheimer's disease (AD). Aβ is generated from the cleavage of C-terminal fragments of the amyloid precursor protein (APP-CTFs) by γ-secretase, an intramembrane-cleaving protease with multiple

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service