Skip to Content
Merck
All Photos(1)

Key Documents

EHU097711

Sigma-Aldrich

MISSION® esiRNA

targeting human PPARG

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€231.00
50 μG
€411.00

€231.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)


Select a Size

Change View
20 μG
€231.00
50 μG
€411.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€231.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAATGTGAAGCCCATTGAAGACATTCAAGACAACCTGCTACAAGCCCTGGAGCTCCAGCTGAAGCTGAACCACCCTGAGTCCTCACAGCTGTTTGCCAAGCTGCTCCAGAAAATGACAGACCTCAGACAGATTGTCACGGAACACGTGCAGCTACTGCAGGTGATCAAGAAGACGGAGACAGACATGAGTCTTCACCCGCTCCTGCAGGAGATCTACAAGGACTTGTACTAGCAGAGAGTCCTGAGCCACTGCCAACATTTCCCTTCTTCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Pradip K Saha et al.
American journal of physiology. Endocrinology and metabolism, 319(4), E667-E677 (2020-08-18)
MicroRNA-30a (miR-30a) impacts adipocyte function, and its expression in white adipose tissue (WAT) correlates with insulin sensitivity in obesity. Bioinformatic analysis demonstrates that miR-30a expression contributes to 2% of all miRNA expression in human tissues. However, molecular mechanisms of miR-30a
Vahid Kheirollahi et al.
Nature communications, 10(1), 2987-2987 (2019-07-07)
Idiopathic pulmonary fibrosis (IPF) is a fatal disease in which the intricate alveolar network of the lung is progressively replaced by fibrotic scars. Myofibroblasts are the effector cells that excessively deposit extracellular matrix proteins thus compromising lung structure and function.
Wenxin Hu et al.
Environmental science & technology, 51(7), 4061-4068 (2017-03-11)
2-Ethylhexyl diphenyl phosphate (EHDPP), an organophosphate flame retardant (OPFR), is frequently detected in human blood. In this study, the sensitive dual-luciferase reporter gene assay and molecular docking were used to investigate the activation of EHDPP to human peroxisome proliferator-activated receptor
Miao Xu et al.
Oncotarget, 8(56), 95914-95930 (2017-12-10)
The poor prognosis of esophageal squamous cell carcinoma (ESCC) emphasizes the urgent need to better understand the carcinogenesis and develop prevention strategies. Previous studies have highlighted the potential of using Vitamin E (tocopherols) for cancer chemoprevention, but the preventive activity

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service