Skip to Content
Merck
All Photos(1)

Key Documents

EHU049311

Sigma-Aldrich

MISSION® esiRNA

targeting human UNC5D

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€231.00
50 μG
€411.00

€231.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
€231.00
50 μG
€411.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€231.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGAGCTCGTTCATGGTTTCCCTGGGAGTGTCTGAGAGAGCTGAGTACCACGGCAAGAATCATTCCAGGACTTTTCCCCATGGAAACAACCACAGCTTTAGTACAATGCATCCCAGAAATAAAATGCCCTACATCCAAAATCTGTCATCACTCCCCACAAGGACAGAACTGAGGACAACTGGTGTCTTTGGCCATTTAGGGGGGCGCTTAGTAATGCCAAATACAGGGGTGAGCTTACTCATACCACACGGTGCCATCCCAGAGGAGAATTCTTGGGAGATTTATATGTCCATCAACCAAGGTGAACCCAGCCTCCAGTCAGATGGCTCTGAGGTGCTCCTGAGTCCTGAAGTCACCTGTGGTCCTCCAGACATGATCGTCACCACTCCCTTTGCATTGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yuyan Zhu et al.
The Journal of urology, 192(2), 575-582 (2014-02-13)
Identifying potential targets would improve therapeutic planning and disease management. Therefore, we investigated whether the novel identified dependence receptor UNC5D acts as a tumor suppressor in bladder malignancies. We assessed the UNC5D level in a panel of 15 primary bladder carcinomas
Priya Srikanth et al.
Translational psychiatry, 8(1), 245-245 (2018-11-10)
The identification of convergent phenotypes in different models of psychiatric illness highlights robust phenotypes that are more likely to be implicated in disease pathophysiology. Here, we utilize human iPSCs harboring distinct mutations in DISC1 that have been found in families

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service