Skip to Content
Merck
All Photos(1)

Key Documents

EHU016101

Sigma-Aldrich

MISSION® esiRNA

targeting human HEG1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€231.00
50 μG
€411.00

€231.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
€231.00
50 μG
€411.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€231.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGAGGAAGTCACACAGCATTGGGAGATAGGAGTTATTCAGAGTCTTCATCTACATCTTCCTCGGAAAGCTTGAATTCATCAGCACCACGTGGAGAACGTTCGATCGCTGGGATTAGCTACGGTCAAGTGCGTGGCACAGCTATTGAACAAAGGACTTCCAGCGACCACACAGACCACACCTACCTGTCATCTACTTTCACCAAAGGAGAACGGGCGTTACTGTCCATTACAGATAACAGTTCATCCTCAGACATTGTGGAGAGCTCAACTTCTTATATTAAAATCTCAAACTCTTCACATTCAGAGTATTCCTCCTTTTTTCATGCTCAGACTGAGAGAAGTAACATCTCATCCTATGACGGGGAATATGCTCAGCCTTCTACTGAGTCGCCAGTTCTGCATACATCCAACCTTCCGTCCTACAC

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tomomi Fujii et al.
Biochemical and biophysical research communications, 526(4), 927-933 (2020-04-15)
Malignant mesothelioma (MM) is a fatal tumor, and the absence of a specific diagnostic marker and/or a pathogenic molecule-targeting drug is a major issue for its pathological diagnosis and for targeting therapy. The molecular target of MM has not been
Shoutaro Tsuji et al.
Scientific reports, 7, 45768-45768 (2017-04-01)
The absence of highly specific markers for malignant mesothelioma (MM) has served an obstacle for its diagnosis and development of molecular-targeting therapy against MM. Here, we show that a novel mucin-like membrane protein, sialylated protein HEG homolog 1 (HEG1), is

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service