Skip to Content
Merck
All Photos(1)

Key Documents

EHU011891

Sigma-Aldrich

MISSION® esiRNA

targeting human RNF168

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€231.00
50 μG
€411.00

€231.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
€231.00
50 μG
€411.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€231.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TATCTCGGCTTCTCCCTTGAATTCCAGAAAATCTGATCCAGTTACACCCAAGTCTGAAAAGAAAAGTAAGAACAAACAAAGAAACACTGGAGATATTCAGAAGTATTTGACACCGAAATCTCAGTTTGGGTCAGCCTCACACTCTGAAGCTGTACAAGAAGTCAGGAAAGACTCCGTATCTAAGGACATTGACAGTAGTGATAGGAAAAGCCCAACAGGGCAAGACACAGAAATAGAAGATATGCCGACACTTTCTCCACAGATATCCCTTGGAGTTGGAGAACAAGGTGCAGATTCTTCAATAGAGTCCCCTATGCCATGGTTATGTGCCTGTGGTGCCGAATGGTACCATGAAGGAAACGTCAAAACAAGACCAAGCAATCATGGGAAAGAGTTATGTGTCTTAAGTCACGAGCGACCTAAAACCAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Stanimir Dulev et al.
Cell cycle (Georgetown, Tex.), 19(1), 15-23 (2019-11-26)
The DNA damage response (DDR) associated post-translational modifications recruit chromatin remodelers, signaling proteins such as 53BP1 and repair factors to chromatin flanking DNA double strand breaks (DSBs) to promote its repair. Although localization of both RNF168 ubiquitin ligase and SET8
Parasvi S Patel et al.
The Journal of clinical investigation, 131(3) (2021-02-03)
Germline mutations in BRCA1 and BRCA2 (BRCA1/2) genes considerably increase breast and ovarian cancer risk. Given that tumors with these mutations have elevated genomic instability, they exhibit relative vulnerability to certain chemotherapies and targeted treatments based on poly (ADP-ribose) polymerase

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service