Skip to Content
Merck
All Photos(1)

Documents

EHU035531

Sigma-Aldrich

MISSION® esiRNA

targeting human UPF1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGACGCCTACCAGTACCAGAACATATTCGGGCCCCTGGTCAAGCTGGAGGCCGACTACGACAAGAAGCTGAAGGAGTCCCAGACTCAAGATAACATCACTGTCAGGTGGGACCTGGGCCTTAACAAGAAGAGAATCGCCTACTTCACTTTGCCCAAGACTGACTCTGACATGCGGCTCATGCAGGGGGATGAGATATGCCTGCGGTACAAAGGGGACCTTGCGCCCCTGTGGAAAGGGATCGGCCACGTCATCAAGGTCCCTGATAATTATGGCGATGAGATCGCCATTGAGCTGCGGAGCAGCGTGGGTGCACCTGTGGAGGTGACTCACAACTTCCAGGTGGATTTTGTGTGGAAGTCGACCTCCTTTGACAGGATGCAGAGCGCATTGAAAACGTTTGCCGTGGATGAGACCTCGGTGTCTGGCTACATCTACCACAAGCTGTTGGGCCACGAGGTGGAGGACGTAAT

Ensembl | human accession no.

ENSG00000005007

NCBI accession no.

NM_002911

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... UPF1(5976) , UPF1(5976)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Seo-Young Lee et al.
Oncogene, 38(10), 1597-1610 (2018-10-24)
The point mutation that substitutes lysine with arginine at position 120 of human p53 has been characterized as a missense mutation. The K120R mutation renders the p53 protein disabled for acetylation and, as a result, defective for apoptotic function, which
Xiaojun Wang et al.
Environmental toxicology, 35(9), 998-1006 (2020-05-14)
The roles of long noncoding RNA (lncRNA) MACC1-AS1 have been revealed in various tumors. This work aims to explore the roles of lncRNA MACC1-AS1 in the stemness of nonsmall cell lung cancer (NSCLC) cells and the underlying mechanism. We showed
Aparna Kishor et al.
Nucleic acids research, 48(13), 7468-7482 (2020-06-17)
Alternative polyadenylation (APA) produces transcript 3' untranslated regions (3'UTRs) with distinct sequences, lengths, stabilities and functions. We show here that APA products include a class of cryptic nonsense-mediated mRNA decay (NMD) substrates with extended 3'UTRs that gene- or transcript-level analyses
Nagakatsu Harada et al.
Journal of cellular biochemistry, 118(11), 3810-3824 (2017-04-07)
Nonsense-mediated mRNA decay (NMD) degrades mRNAs carrying a premature termination codon (PTC) in eukaryotes. Cellular stresses, including endoplasmic reticulum (ER) stress, inhibit NMD, and up-regulate PTC-containing mRNA (PTC-mRNA) levels in several cell lines. However, whether similar effects exist under in
Tatsuaki Kurosaki et al.
Nature cell biology, 23(1), 40-48 (2021-01-10)
Loss of the fragile X protein FMRP is a leading cause of intellectual disability and autism1,2, but the underlying mechanism remains poorly understood. We report that FMRP deficiency results in hyperactivated nonsense-mediated mRNA decay (NMD)3,4 in human SH-SY5Y neuroblastoma cells
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service