Skip to Content
Merck
All Photos(1)

Key Documents

EMU071391

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Abl1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
PLN 1,060.00
50 μG
PLN 1,910.00

PLN 1,060.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
PLN 1,060.00
50 μG
PLN 1,910.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

PLN 1,060.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACCTTGAAGGAGGACACCATGGAGGTGGAGGAGTTCCTGAAGGAAGCGGCGGTGATGAAGGAGATCAAACACCCTAACCTGGTGCAGCTGCTAGGGGTGTGTACCCGGGAACCACCATTCTACATAATCACTGAGTTCATGACCTATGGGAACCTGCTGGACTACCTGAGGGAGTGTAACCGGCAGGAGGTGAGCGCCGTGGTACTGCTCTACATGGCCACACAGATCTCATCAGCCATGGAGTACTTGGAGAAGAAGAACTTCATCCACAGAGACCTTGCTGCCCGGAACTGCCTGGTAGGGGAAAACCACTTGGTGAAGGTGGCTGATTTTGGCCTGAGCAGGTTGATGACAGGGGACACCTACACGGCCCATGCTGGAGCCAAATTCCCCATCAAATGGACCGCACCTGAGAGCCTGGCCTACAAC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Carolin F Manthey et al.
American journal of physiology. Cell physiology, 307(2), C180-C189 (2014-05-23)
Enteropathogenic Escherichia coli (EPEC) and Citrobacter rodentium are attaching-and-effacing (A/E) pathogens that cause intestinal inflammation and diarrhea. The bacteria adhere to the intestinal epithelium, destroy microvilli, and induce actin-filled membranous pedestals but do not invade the mucosa. Adherence leads to
Zannel Blanchard et al.
PloS one, 9(4), e95663-e95663 (2014-05-03)
Breast cancer is the second leading cause of cancer-related deaths in women. Triple negative breast cancer (TNBC) is an aggressive subtype that affects 10-25% mostly African American women. TNBC has the poorest prognosis of all subtypes with rapid progression leading

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service