Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU109591

Sigma-Aldrich

MISSION® esiRNA

targeting human PHB

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCTGAGCAACAGAAAAAGGCGGCCATCATCTCTGCTGAGGGCGACTCCAAGGCAGCTGAGCTGATTGCCAACTCACTGGCCACTGCAGGGGATGGCCTGATCGAGCTGCGCAAGCTGGAAGCTGCAGAGGACATCGCGTACCAGCTCTCACGCTCTCGGAACATCACCTACCTGCCAGCGGGGCAGTCCGTGCTCCTCCAGCTGCCCCAGTGAGGGCCCACCCTGCCTGCACCTCCGCGGGCTGACTGGGCCACAGCCCCGATGATTCTTAACACAGCCTTCCTTCTGCTCCCACCCCAGAAATCACTGTGAAATTTCATGATTGGCTTAAAGTGAAGGAAATAAAGGTAAAATCACTTCAGATCTCTAATTAGTCTATCAAATGAAACTCTTTCATTCTTCTCACATCCATCTACTTTTTTATCCACCTCCCTACCAAAAATTGCCAAGTGCCTATGCAAACCAGCT

Ensembl | human accession no.

ENSG00000167085

NCBI accession no.

NM_002634

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PHB(5245) , PHB(5245)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lijun Sun et al.
Biochemical and biophysical research communications, 513(2), 446-451 (2019-04-11)
Influenza virus infection is associated with type 1 diabetes (T1DM), but its pathogenesis remains unclear. Here, our study found that one of the monoclonal antibodies against H1N1 influenza virus hemagglutinin(HA) cross-reacted with human pancreatic tissue and further demonstrated that it
Debabrata Chowdhury et al.
Molecular and cellular biochemistry, 425(1-2), 155-168 (2016-11-18)
Numerous hypertrophic stimuli, including β-adrenergic agonists such as isoproterenol (ISO), result in generation of reactive oxygen species (ROS) and alteration in the mitochondrial membrane potential (Δψ) leading to oxidative stress. This process is well associated with phosphorylation of thymoma viral
Kinnosuke Yahiro et al.
Cellular microbiology, 21(8), e13033-e13033 (2019-04-23)
Vibrio cholerae produced-Cholix toxin (Cholix) is a cytotoxin that ADP-ribosylates eukaryotic elongation factor 2, inhibiting protein synthesis, and inducing apoptosis. Here, we identified prohibitin (PHB) 1 and 2 as novel Cholix-interacting membrane proteins in immortalised human hepatocytes and HepG2 cells
Hajime Yurugi et al.
Journal of cell science, 133(12) (2020-06-06)
The RAS oncogenes are frequently mutated in human cancers and among the three isoforms (KRAS, HRAS and NRAS), KRAS is the most frequently mutated oncogene. Here, we demonstrate that a subset of flavaglines, a class of natural anti-tumour drugs and
Satomi Miwa et al.
Nature communications, 5, 3837-3837 (2014-05-13)
Mitochondrial function is an important determinant of the ageing process; however, the mitochondrial properties that enable longevity are not well understood. Here we show that optimal assembly of mitochondrial complex I predicts longevity in mice. Using an unbiased high-coverage high-confidence

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico