Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU032931

Sigma-Aldrich

MISSION® esiRNA

targeting human P4HB

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CATCGTGAACTGGCTGAAGAAGCGCACGGGCCCGGCTGCCACCACCCTGCCTGACGGCGCAGCTGCAGAGTCCTTGGTGGAGTCCAGCGAGGTGGCTGTCATCGGCTTCTTCAAGGACGTGGAGTCGGACTCTGCCAAGCAGTTTTTGCAGGCAGCAGAGGCCATCGATGACATACCATTTGGGATCACTTCCAACAGTGACGTGTTCTCCAAATACCAGCTCGACAAAGATGGGGTTGTCCTCTTTAAGAAGTTTGATGAAGGCCGGAACAACTTTGAAGGGGAGGTCACCAAGGAGAACCTGCTGGACTTTATCAAACACAACCAGCTGCCCCTTGTCATCGAGTTCACCGAGCAGACAGCCCCGAAGATTTTTGGAGGTGAAATCAAGACTCACATCCTGCTGTTCTTGC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rashed Alhammad et al.
Oncology reports, 44(6), 2406-2418 (2020-10-31)
Oxidoreductase protein disulphide isomerases (PDI) are involved in the regulation of a variety of biological processes including the modulation of endoplasmic reticulum (ER) stress, unfolded protein response (UPR), ER‑mitochondria communication and the balance between pro‑survival and pro‑death pathways. In the
Wei Xia et al.
Oncotarget, 8(5), 8512-8521 (2017-01-05)
P4HB and GRP78 are molecular chaperones involved in cellular response to ER stress. They have been linked to cancer progression; however, their roles in hepatocellular carcinoma (HCC) are largely unclear. In this study, we found that P4HB is overexpressed in
Xiu-Juan Ding et al.
Theranostics, 10(24), 11110-11126 (2020-10-13)
Rationale: Many external factors can induce the melanogenesis and inflammation of the skin. Salidroside (SAL) is the main active ingredient of Rhodiola, which is a perennial grass plant of the Family Crassulaceae. This study evaluated the effect and molecular mechanism
Yajing Liu et al.
Cancer research, 79(11), 2923-2932 (2019-04-19)
Patients with glioblastoma multiforme (GBM) survive on average 12 to 14 months after diagnosis despite surgical resection followed by radiotheraphy and temozolomide therapy. Intrinsic or acquired resistance to chemo- and radiotherapy is common and contributes to a high rate of
Xing Ma et al.
Oncology letters, 20(1), 257-265 (2020-06-23)
The aim of the present study was to investigate the role of prolyl 4-hydroxylase beta polypeptide (P4HB) in the chemoresistance of liver cancer. Drug-resistant liver cancer cell lines, such as HepG2/adriamycin (ADR) cells, were treated and screened using adriamycin. Gene

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico