Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU089521

Sigma-Aldrich

MISSION® esiRNA

targeting human ATM

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACGTTACATGAGCCAGCAAATTCTAGTGCCAGTCAGAGCACTGACCTCTGTGACTTTTCAGGGGATTTGGATCCTGCTCCTAATCCACCTCATTTTCCATCGCATGTGATTAAAGCAACATTTGCCTATATCAGCAATTGTCATAAAACCAAGTTAAAAAGCATTTTAGAAATTCTTTCCAAAAGCCCTGATTCCTATCAGAAAATTCTTCTTGCCATATGTGAGCAAGCAGCTGAAACAAATAATGTTTATAAGAAGCACAGAATTCTTAAAATATATCACCTGTTTGTTAGTTTATTACTGAAAGATATAAAAAGTGGCTTAGGAGGAGCTTGGGCCTTTGTTCTTCGAGACGTTATTTATACTTTGATTCACTATATCAACCAAAGGCCTTCTTGT

Ensembl | human accession no.

ENSG00000149311

NCBI accession no.

NM_138292

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ATM(472) , ATM(472)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Vinod Vijay Subhash et al.
Molecular cancer therapeutics, 15(12), 3087-3096 (2016-09-18)
Identification of synthetically lethal cellular targets and synergistic drug combinations is important in cancer chemotherapy as they help to overcome treatment resistance and increase efficacy. The Ataxia Telangiectasia Mutated (ATM) kinase is a nuclear protein that plays a major role
Wioleta Grabowska et al.
Biogerontology, 20(6), 783-798 (2019-08-03)
Curcumin, a phytochemical present in the spice named turmeric, and one of the promising anti-aging factors, is itself able to induce cellular senescence. We have recently shown that cells building the vasculature senesced as a result of curcumin treatment. Curcumin-induced
Hongbo Chen et al.
Oncotarget, 7(50), 83241-83257 (2016-11-10)
PICT-1 is an essential ribosome biogenesis factor whose loss induces p53 accumulation and apoptosis. Here, we show that DNA damage changes PICT-1 localization and decreases PICT-1 protein levels via the proteasome pathway. Two important phosphatidylinositol 3-kinase-like kinases (PIKKs), ataxia-telangiectasia mutated
Jung-Hee Lee et al.
Nature communications, 8(1), 903-903 (2017-10-14)
MDC1 plays a critical role in the DNA damage response (DDR) by interacting directly with several factors including γ-H2AX. However, the mechanism by which MDC1 is recruited to damaged sites remains elusive. Here, we show that MDC1 interacts with a
Emily A Resseguie et al.
Redox biology, 5, 176-185 (2015-05-15)
High levels of oxygen (hyperoxia) are often used to treat individuals with respiratory distress, yet prolonged hyperoxia causes mitochondrial dysfunction and excessive reactive oxygen species (ROS) that can damage molecules such as DNA. Ataxia telangiectasia mutated (ATM) kinase is activated
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico