Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU076261

Sigma-Aldrich

MISSION® esiRNA

targeting human ABCC1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGATGTCATCTGAAATGGAAACCAACATCGTGGCCGTGGAGAGGCTCAAGGAGTATTCAGAGACTGAGAAGGAGGCGCCCTGGCAAATCCAGGAGACAGCTCCGCCCAGCAGCTGGCCCCAGGTGGGCCGAGTGGAATTCCGGAACTACTGCCTGCGCTACCGAGAGGACCTGGACTTCGTTCTCAGGCACATCAATGTCACGATCAATGGGGGAGAAAAGGTCGGCATCGTGGGGCGGACGGGAGCTGGGAAGTCGTCCCTGACCCTGGGCTTATTTCGGATCAACGAGTCTGCCGAAGGAGAGATCATCATCGATGGCATCAACATCGCCAAGATCGGCCTGCACGACCTCCGCTTCAAGATCACCATCATCCCCCAGGACCCTGTTTTGTTTTCGGGTTCCCT

Ensembl | human accession no.

ENSG00000103222

NCBI accession no.

NM_004996

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ABCC1(4363) , ABCC1(4363)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dalila Naci et al.
Scientific reports, 9(1), 19455-19455 (2019-12-21)
Chemoresistance is a major hurdle in anti-cancer therapy. Growing evidence indicates that integrin-mediated cell adhesion to extracellular matrix plays a major role in chemoresistance. However, the underlying mechanisms are not fully understood. We have previously shown that the collagen-binding integrin
F Anthony Willyerd et al.
Journal of neurotrauma, 33(2), 226-231 (2015-04-22)
Adenosine triphosphate-binding cassette (ABC) transport proteins ABCC1 and ABCB1 (also known as multidrug resistance-associated protein 1 and p-glycoprotein, respectively), are key membrane efflux transporters of drugs and endogenous substrates, including in the brain. The impact of traumatic brain injury (TBI)
Yan Li et al.
Journal of molecular histology, 46(4-5), 357-364 (2015-06-21)
Multidrug resistance-associated protein 1 (MRP1) belongs to ATP-binding cassette transporters family. The overexpression of MRP1 is predominantly related with the failure of chemo-radiotherapy in various tumors. However, its possible role in hypertrophic scar (HS) is hardly investigated. Here we showed
M Hasanzadeh Kafshgari et al.
Biomaterials science, 3(12), 1555-1565 (2015-09-08)
In this study, thermally hydrocarbonised porous silicon nanoparticles (THCpSiNPs) capped with polyethylenimine (PEI) were fabricated, and their potential for small interfering RNA (siRNA) delivery was investigated in an in vitro glioblastoma model. PEI coating following siRNA loading enhanced the sustained

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico