Skip to Content
Merck
All Photos(1)

Key Documents

EHU052611

Sigma-Aldrich

MISSION® esiRNA

targeting human CD99

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€195.00
50 μG
€346.00

€195.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
€195.00
50 μG
€346.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€195.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGATTGTCGGCAGAAACAGCCCAGGCGTTGGCAGCAGGGTTAGAACAGCTGCCTGAGGCTCCTCCCTGAAGGACACCTGCCTGAGAGCAGAGATGGAGGCCTTCTGTTCACGGCGGATTCTTTGTTTTAATCTTGCGATGTGCTTTGCTTGTTGCTGGGCGGATGATGTTTACTAACGATGAATTTTACATCCAAAGGGGGATAGGCACTTGGACCCCCATTCTCCAAGGCCCGGGGGGGCGGTTTCCCATGGGATGTGAAAGGCTGGCCATTATTAAGTCCCTGTAACTCAAATGTCAACCCCACCGAGGCACCCCCCCGTCCCCCAGAATCTTGGCTGTTTACAAATCACGTGTCCATCGAGCACGTCTGAAACCCCTGGTAGCCCCGACTTCTTTTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lais C Cardoso et al.
International journal of molecular sciences, 20(5) (2019-03-09)
Glioblastoma (GBM) is the most aggressive type of brain tumor, with an overall survival of 17 months under the current standard of care therapy. CD99, an over-expressed transmembrane protein in several malignancies, has been considered a potential target for immunotherapy.
Tillmann Bedau et al.
Oncotarget, 8(33), 54873-54888 (2017-09-15)
Transendothelial cell migration (TEM) is crucial for inflammation and metastasis. The adhesion molecule CD99 was shown to be important for correct immune cell extravasation and is highly expressed on certain cancer cells. Recently, we demonstrated that ectodomain shedding of CD99
Jianfa Wu et al.
Biochemical and biophysical research communications, 518(4), 698-705 (2019-09-02)
Cisplatin resistance is a vital obstacle for the prognosis of ovarian cancer. However, the mechanism of cisplatin resistance is still unknown. This research was performed to explore the role of Nrf2 (nuclear factor, erythroid 2 like 2) and CD99 (CD99

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service