Skip to Content
Merck
All Photos(1)

Key Documents

EHU031481

Sigma-Aldrich

MISSION® esiRNA

targeting human USP14

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€195.00
50 μG
€346.00

€195.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
€195.00
50 μG
€346.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€195.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAGCAGATGCTCTTCCAGAAGAACCCTCAGCCAAAACTGTCTTCGTAGAAGACATGACAGAAGAACAGTTAGCATCTGCTATGGAGTTACCATGTGGATTGACAAACCTTGGTAACACTTGTTACATGAATGCCACAGTTCAGTGTATTCGTTCTGTGCCTGAACTCAAAGATGCCCTTAAAAGGTATGCAGGTGCCTTGAGAGCTTCAGGGGAAATGGCTTCAGCGCAGTATATTACTGCAGCCCTTAGAGATTTGTTTGATTCCATGGATAAAACTTCTTCCAGTATTCCACCTATTATTCTACTGCAGTTTTTGCACATGGCTTTCCCACAGTTTGCCGAGAAAGGTGAACAAGGACAGTATCTTCAACAGGATGCTAATGAATGTTGGATACAAATGATGCGAGTATTGCAACAGAAATTGGAAGCAATAGAGGATGATTCTGTTAAAGAGACAGACTCCTCATCTGCATCGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ying Zhu et al.
Oncotarget, 8(30), 48725-48736 (2016-07-28)
Vimentin plays important roles in the epithelial-to-mesenchymal transition (EMT). In this study, we found that vimentin was highly expressed in human gastric cancer (GC) tissues and cell lines and significantly promoted cell growth, migration and invasion. Ubiquitin-specific protease 14 (USP14)
Vignesh Srinivasan et al.
iScience, 23(1), 100790-100790 (2020-01-07)
USP14 is a deubiquitinating enzyme associated with the proteasome important for protein degradation. Here we show that upon proteasome inhibition or expression of the mutant W58A-USP14, association of USP14 with the 19S regulatory particle is disrupted. MS-based interactomics revealed an
Susu Guo et al.
Cell death & disease, 12(1), 42-42 (2021-01-09)
The regulation of homeostasis in the Ubiquitin (Ub) proteasome system (UPS) is likely to be important for the development of liver cancer. Tribbles homolog 2 (TRIB2) is known to affect Ub E3 ligases (E3s) in liver cancer. However, whether TRIB2

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service