Skip to Content
Merck
All Photos(1)

Key Documents

EHU008491

Sigma-Aldrich

MISSION® esiRNA

targeting human IL33

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTTGCTTTGGAGGATGAAAGTTATGAGATATATGTTGAAGACTTGAAAAAAGATGAAAAGAAAGATAAGGTGTTACTGAGTTACTATGAGTCTCAACACCCCTCAAATGAATCAGGTGACGGTGTTGATGGTAAGATGTTAATGGTAACCCTGAGTCCTACAAAAGACTTCTGGTTGCATGCCAACAACAAGGAACACTCTGTGGAGCTCCATAAGTGTGAAAAACCACTGCCAGACCAGGCCTTCTTTGTCCTTCATAATATGCACTCCAACTGTGTTTCATTTGAATGCAAGACTGATCCTGGAGTGTTTATAGGTGTAAAGGATAATCATCTTGCTCTGATTAAAGTAGACTCTTCTGAGAATTTGTGTACTGAAAATATCTTGTTTAAGCTCTCTGAAACTTAGTTGATGGAAACCTGTGAGTCTTGGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Weronika Gonciarz et al.
International journal of molecular sciences, 21(5) (2020-03-11)
Interleukin (IL)-33 is a proinflammatory mediator that alerts the host immune system to disorders in tissue homeostasis. Aim. To understand the role of IL-33 in modulating gastric tissue cell growth affected by Helicobacter pylori (H. pylori). Methods. IL-33 production in
Dongmin Shao et al.
Biochemical and biophysical research communications, 451(1), 8-14 (2014-07-09)
Idiopathic pulmonary arterial hypertension (IPAH) is an incurable condition leading to right ventricular failure and death and inflammation is postulated to be associated with vascular remodelling. Interleukin (IL)-33, a member of the "alarmin" family can either act on the membrane
Haiyan Hu et al.
Biochemical and biophysical research communications, 485(3), 643-650 (2017-02-22)
Breast cancers with estrogen receptor (ER) expressions account for the majority of all clinical cases. Due to hormone therapy with tamoxifen, prognoses of patients with ER-positive breast cancer are significantly improved. However, endocrine resistance to tamoxifen is common and inevitable
Meng Li et al.
International journal of molecular sciences, 22(5) (2021-03-07)
Short-chain fatty acids (e.g., butyrate and propionate) are able to diminish endothelial cell activation. The aim of this study was to investigate whether intracellular IL-33 mediates the effects of butyrate and propionate on TNFα-induced IL-8 production and vascular cell adhesion
Supaporn Yangngam et al.
Journal of Cancer, 11(22), 6571-6581 (2020-10-14)
Interleukin 33 (IL-33) promotes cholangiocarcinoma (CCA) genesis in a mouse model, however, its function in human CCA has not been clearly understood. This study was aimed to investigate IL-33 level in CCA tissues and its clinicopathological correlations. The results revealed

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service