Skip to Content
Merck
All Photos(1)

Key Documents

EHU002801

Sigma-Aldrich

MISSION® esiRNA

targeting human EPHA3

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€195.00
50 μG
€346.00

€195.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
€195.00
50 μG
€346.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€195.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGTGGACATCACCAGAAGCTATAGCCTACCGCAAGTTCACGTCAGCCAGCGATGTATGGAGTTATGGGATTGTTCTCTGGGAGGTGATGTCTTATGGAGAGAGACCATACTGGGAGATGTCCAATCAGGATGTAATTAAAGCTGTAGATGAGGGCTATCGACTGCCACCCCCCATGGACTGCCCAGCTGCCTTGTATCAGCTGATGCTGGACTGCTGGCAGAAAGACAGGAACAACAGACCCAAGTTTGAGCAGATTGTTAGTATTCTGGACAAGCTTATCCGGAATCCCGGCAGCCTGAAGATCATCACCAGTGCAGCCGCAAGGCCATCAAACCTTCTTCTGGACCAAAGCAATGTGGATATCACTACCTTCCGCACAACAGGTGACTGGCTTAATGGTGTCTGGACAGCACACTGCAAGGAAATCTTCACGGGTGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Maleeha A Qazi et al.
Cancer research, 78(17), 5023-5037 (2018-06-28)
Glioblastoma (GBM) carries a dismal prognosis and inevitably relapses despite aggressive therapy. Many members of the Eph receptor tyrosine kinase (EphR) family are expressed by GBM stem cells (GSC), which have been implicated in resistance to GBM therapy. In this
Song Hee Kim et al.
Cellular signalling, 47, 122-130 (2018-04-14)
Radiotherapy is a well-established therapeutic modality used in the treatment of many cancers. However, radioresistance remains a serious obstacle to successful treatment. Radioresistance can cause local recurrence and distant metastases in some patients after radiation treatment. Thus, many studies have
Hemei Xiao et al.
Cell biology international (2018-04-17)
MicroRNAs (miRNAs) play key roles in cervical cancer metastasis progression. Accumulated evidences have revealed that miRNAs are related to the pathophysiological process. However, the role of miR-340 in cervical cancer and how it works is still not fully interpreted. Using
Antonella Caivano et al.
Oncotarget, 8(21), 34298-34309 (2017-04-19)
This study investigates the role of ephrin receptor A3 (EphA3) in the angiogenesis of Multiple Myeloma (MM) and the effects of a selective target of EphA3 by a specific monoclonal antibody on primary bone marrow endothelial cells (ECs) of MM
Xiaole Chen et al.
Molecular cancer research : MCR, 16(5), 909-919 (2018-02-18)
The Hedgehog (Hh) receptor Patched1 (PTCH1) is a well-known tumor suppressor that in its active form represses Smoothened (SMO) activity, inhibits proliferation, and induces apoptosis. The cytoplasmic C-terminal domain (CTD) regulates PTCH1 turnover and nucleates a proapoptotic complex. In this

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service