Skip to Content
Merck
All Photos(1)

Key Documents

EHU073641

Sigma-Aldrich

MISSION® esiRNA

targeting human ARNTL

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
RM 1,248.00
50 μG
RM 2,221.00

RM 1,248.00


Estimated to ship on31 May 2025



Select a Size

Change View
20 μG
RM 1,248.00
50 μG
RM 2,221.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

RM 1,248.00


Estimated to ship on31 May 2025


description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGAGGGACTCCAGACATTCCTTCCAGTGGCCTACTATCAGGCCAGGCTCAGGAGAACCCAGGTTATCCATATTCTGATAGTTCTTCTATTCTTGGTGAGAACCCCCACATAGGTATAGACATGATTGACAACGACCAAGGATCAAGTAGTCCCAGTAATGATGAGGCAGCAATGGCTGTCATCATGAGCCTCTTGGAAGCAGATGCTGGACTGGGTGGCCCTGTTGACTTTAGTGACTTGCCATGGCCGCTGTAAACACTACATGTTGCTTTGGCAACAGCTATAGTATCAAAGTGCATTACTGGTGGAGTTTTACAGTCTGTGAAGCTTACTGGATAAGGAGAGAATAGCTTTTATGTACTGACTTCATAAAAGCCATCTCAGAGCCATTGATACAAGTCAATCTTACTATATGTAACTTCAGACAAAGTGGAACTAAGCCTGCTCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hisashi Kato et al.
International journal of molecular sciences, 21(18) (2020-09-25)
Exercise training is well known to enhance adipocyte lipolysis in response to hormone challenge. However, the existence of a relationship between the timing of exercise training and its effect on adipocyte lipolysis is unknown. To clarify this issue, Wistar rats
Nikolai Genov et al.
Scientific reports, 9(1), 11062-11062 (2019-08-01)
The circadian clock regulates key cellular processes and its dysregulation is associated to several pathologies including cancer. Although the transcriptional regulation of gene expression by the clock machinery is well described, the role of the clock in the regulation of
Whitney Sussman et al.
American journal of physiology. Cell physiology, 317(3), C492-C501 (2019-06-20)
The transcription factor aryl hydrocarbon receptor nuclear translocator-like protein-1 (BMAL1) is an essential regulator of the circadian clock, which controls the 24-h cycle of physiological processes such as nutrient absorption. To examine the role of BMAL1 in small intestinal glucose
Silke Kiessling et al.
BMC biology, 15(1), 13-13 (2017-02-16)
Circadian clocks control cell cycle factors, and circadian disruption promotes cancer. To address whether enhancing circadian rhythmicity in tumor cells affects cell cycle progression and reduces proliferation, we compared growth and cell cycle events of B16 melanoma cells and tumors
Do Hyeong Gwon et al.
International journal of molecular sciences, 21(7) (2020-04-02)
Several studies have shown that brain and muscle aryl hydrocarbon receptor nuclear translocator-like 1 (BMAL1), an important molecule for maintaining circadian rhythms, inhibits the growth and metastasis of tumor cells in several types of cancer, including lung, colon, and breast

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service