Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU115611

Sigma-Aldrich

MISSION® esiRNA

targeting human NPM1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGGTGCAAAGGATGAGTTGCACATTGTTGAAGCAGAGGCAATGAATTACGAAGGCAGTCCAATTAAAGTAACACTGGCAACTTTGAAAATGTCTGTACAGCCAACGGTTTCCCTTGGGGGCTTTGAAATAACACCACCAGTGGTCTTAAGGTTGAAGTGTGGTTCAGGGCCAGTGCATATTAGTGGACAGCACTTAGTAGCTGTGGAGGAAGATGCAGAGTCAGAAGATGAAGAGGAGGAGGATGTGAAACTCTTAAGTATATCTGGAAAGCGGTCTGCCCCTGGAGGTGGTAGCAAGGTTCCACAGAAAAAAGTAAAACTTGCTGCTGATGAAGATGATGACGATGATGATGAAGAGGATGATGATGAAGATGATGATGATGATGATTTTGATGATGAGGAAGCTGAAGAAAAAGCGCCAGTGAAGAAA

Ensembl | human accession no.

ENSG00000181163

NCBI accession no.

NM_199185

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NPM1(4869) , NPM1(4869)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Derek Hang-Cheong Cheung et al.
Scientific reports, 7, 43650-43650 (2017-03-04)
Telomerase activation and telomere maintenance are critical for cellular immortalization and transformation. PIN2/TERF1-interacting telomerase inhibitor 1 (PinX1) is a telomerase regulator and the aberrant expression of PinX1 causes telomere shortening. Identifying PinX1-interacting proteins is important for understanding telomere maintenance. We
Qing-Qing Wang et al.
Chinese journal of cancer, 30(12), 853-860 (2011-11-22)
Nucleophosmin/B23 (NPM) is a universally expressed nucleolar phosphoprotein that participates in proliferation, apoptosis, ribosome assembly, and centrosome duplication; however, the role of NPM in cell cycle regulation is not well characterized. We investigated the mechanism by which NPM is involved
Laura Arnoldo et al.
Scientific reports, 5, 8552-8552 (2015-02-26)
High Mobility Group A are non-histone nuclear proteins that regulate chromatin plasticity and accessibility, playing an important role both in physiology and pathology. Their activity is controlled by transcriptional, post-transcriptional, and post-translational mechanisms. In this study we provide evidence for
L Lam et al.
Oncogenesis, 1, e4-e4 (2012-01-01)
Nucleophosmin (NPM) is a nucleolar phosphoprotein that is involved in many cellular processes and has both oncogenic and growth suppressing activities. NPM is localized primarily in nucleoli but shuttles between the nucleus and the cytoplasm, and sustained cytoplasmic distribution contributes
Dan Li et al.
The American journal of Chinese medicine, 45(3), 599-614 (2017-04-08)
Abundant evidence supports the key role of ultraviolet radiation (UVR) in skin cancer development. The human skin, especially the epidermal layer, is the main defense against UV radiation. Baicalin is a major bioactive component of Scutellaria baicalensis Georgi, a plant
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico