Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU111091

Sigma-Aldrich

MISSION® esiRNA

targeting human XIAP

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00

Check Cart for Availability
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00

Check Cart for Availability

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCATGGCAGATTATGAAGCACGGATCTTTACTTTTGGGACATGGATATACTCAGTTAACAAGGAGCAGCTTGCAAGAGCTGGATTTTATGCTTTAGGTGAAGGTGATAAAGTAAAGTGCTTTCACTGTGGAGGAGGGCTAACTGATTGGAAGCCCAGTGAAGACCCTTGGGAACAACATGCTAAATGGTATCCAGGGTGCAAATATCTGTTAGAACAGAAGGGACAAGAATATATAAACAATATTCATTTAACTCATTCACTTGAGGAGTGTCTGGTAAGAACTACTGAGAAAACACCATCACTAACTAGAAGAATTGATGATACCATCTTCCAAAATCCTATGGTACAAGAAGCTATACGAATGGGGTTCAGTTTCAAGGACATTAAGAAAATAATGGAGGAAAAAATTCAGATATCTGGGAGCAACTATAAATCACTTGAGGTTCTGGTTGCA

Ensembl | nº de acceso humano

ENSG00000101966

Nº de acceso NCBI

NM_001167

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... XIAP(331) , XIAP(331)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
XZU
ZYU
KXU
OWU
QDU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Morikazu Miyamoto et al.
Anticancer research, 38(1), 301-306 (2017-12-27)
To investigate whether XIAP down-regulation and autophagy inhibition sensitize ovarian clear cell cancer cells to cisplatin. The ovarian clear cancer cell line KK was used for in vitro analysis. Hydroxychloroquine (HCQ) and phenoxodiol (PXD) or embelin were used as autophagy
Ying Hou et al.
Journal of cell science, 130(2), 502-511 (2016-12-09)
Regulation of cell death is crucial for the response of cancer cells to drug treatments that cause arrest in mitosis, and is likely to be important for protection against chromosome instability in normal cells. Prolonged mitotic arrest can result in
Ke Ren et al.
Pathology oncology research : POR, 25(1), 341-348 (2017-11-11)
To find the exact downstream effector of Pim-2 pathway in prostate cancer cells, and to determine the means by which it affects prostate cancer. XIAP, Pim-2 and p-eIF4B expressions were detected in PCA and BPH tissues. Then the Pim-2 and
Yong Liu et al.
Cell death & disease, 8(3), e2685-e2685 (2017-03-17)
Severe acute pancreatitis (SAP) still remains a clinical challenge, not only for its high mortality but the uncontrolled inflammatory progression from acute pancreatitis (AP) to SAP. Cell death, including apoptosis and necrosis are critical pathology of AP, since the severity
Azhar R Hussain et al.
BMC cancer, 17(1), 640-640 (2017-09-13)
Breast cancer is the most common cancer in females and is ranked second in cancer-related deaths all over the world in women. Despite improvement in diagnosis, the survival rate of this disease has still not improved. X-linked Inhibitor of Apoptosis
Ver todos los artículos relacionados

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico