Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU091111

Sigma-Aldrich

MISSION® esiRNA

targeting human UBE2K

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCGCACGGTATTATTGTCATTGCAAGCACTATTGGCAGCTGCAGAGCCAGATGATCCACAGGATGCTGTAGTAGCAAATCAGTACAAACAAAATCCCGAAATGTTCAAACAGACAGCTCGACTTTGGGCACATGTGTATGCTGGAGCACCAGTTTCTAGTCCAGAATACACCAAAAAAATAGAAAACCTATGTGCTATGGGCTTTGATAGGAATGCAGTAATAGTGGCCTTGTCTTCAAAATCATGGGATGTAGAGACTGCAACAGAATTGCTTCTGAGTAACTGAGGCATAGAGAGCTGCTGATATAGTCAAGCTTGCCTCTTCTTGAGGAGCACCAACATCTGTTATTTTTAGGATTCTGCATAGATTTCTTTTAAACTGGCATTCTTGCCTAATGATGTTATCTAGGCACCATTGGAGACTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Eun Il Jeong et al.
Cell death & disease, 7(12), e2573-e2573 (2016-12-30)
Cerebral ischemia/reperfusion (I/R) causes brain damage accompanied by ubiquitin accumulation and impairment of proteasome activity. In this study, we report that E2-25K, an E2-conjugating enzyme, is SUMOylated during oxidative stress and regulates cerebral I/R-induced damage. Knockdown of E2-25K expression protects
Lisa Schmölz et al.
Biochimica et biophysica acta, 1863(8), 919-927 (2018-05-08)
The long-chain metabolites of vitamin E (LCM) emerge as a new class of regulatory metabolites and have been considered as the active compounds formed during vitamin E metabolism. The bioactivity of the LCM is comparable to the already established role
Wen-Bin Gu et al.
Developmental and comparative immunology, 101, 103452-103452 (2019-07-19)
NFIL3 is a transcriptional activator of the IL-3 promoter in T cells. In vertebrates, it has been characterized as an essential regulator of several cellular processes such as immunity response, apoptosis and NK cells maturation. However, the identification and functional

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico